ID: 1084102304

View in Genome Browser
Species Human (GRCh38)
Location 11:66957890-66957912
Sequence CTGAGCCACATCCAGTACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084102299_1084102304 10 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102304 11:66957890-66957912 CTGAGCCACATCCAGTACGATGG 0: 1
1: 0
2: 0
3: 2
4: 87
1084102302_1084102304 -5 Left 1084102302 11:66957872-66957894 CCGCGGCTTCCTGCAGAGCTGAG 0: 1
1: 0
2: 17
3: 260
4: 4139
Right 1084102304 11:66957890-66957912 CTGAGCCACATCCAGTACGATGG 0: 1
1: 0
2: 0
3: 2
4: 87
1084102300_1084102304 9 Left 1084102300 11:66957858-66957880 CCTCGCCTTACACGCCGCGGCTT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1084102304 11:66957890-66957912 CTGAGCCACATCCAGTACGATGG 0: 1
1: 0
2: 0
3: 2
4: 87
1084102301_1084102304 4 Left 1084102301 11:66957863-66957885 CCTTACACGCCGCGGCTTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1084102304 11:66957890-66957912 CTGAGCCACATCCAGTACGATGG 0: 1
1: 0
2: 0
3: 2
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084102304 Original CRISPR CTGAGCCACATCCAGTACGA TGG Intronic
904842470 1:33381952-33381974 CTGATTCTCATCCAGTACCATGG + Intronic
906419679 1:45654677-45654699 CTGTGCCACCTCCACTACGTTGG + Exonic
907454379 1:54565762-54565784 CTGGGACAGATCCAGTAGGAGGG - Intronic
908803919 1:67909958-67909980 TTGAGCCACAGCCCGTAGGATGG - Intergenic
909415135 1:75397915-75397937 CTGACCCACATTCATTAGGATGG + Intronic
915516314 1:156414668-156414690 TAGAGCCACATCCAGCACCACGG - Exonic
918240113 1:182613459-182613481 CTGCCCCACATCCAGAAGGAAGG - Intergenic
918699658 1:187592023-187592045 CTGCCCCACATCCAGAAGGAAGG + Intergenic
1065232464 10:23612344-23612366 CTGATCCCCCTCCAGGACGAAGG - Intergenic
1067582143 10:47452609-47452631 CTGTGCCACCTCCAGCACCATGG + Intergenic
1072470798 10:95711302-95711324 CTGTCCCACATCCAGAAGGAAGG + Intergenic
1077755848 11:5026233-5026255 CTCAGCCACAACCACTACTAAGG + Intergenic
1078107020 11:8364981-8365003 CTGAGCCACATCTATGAAGAGGG + Intergenic
1083292140 11:61696232-61696254 CTGAGGCACAGCCAGGCCGAGGG - Intronic
1084102304 11:66957890-66957912 CTGAGCCACATCCAGTACGATGG + Intronic
1088893565 11:114061780-114061802 GTGAGTTACAACCAGTACGAAGG - Intronic
1089572909 11:119422231-119422253 CTGAGCCAGATCCAGGAGGAAGG + Intronic
1091324092 11:134671171-134671193 CTGAGACACATCCATTCGGAAGG + Intergenic
1093234592 12:16591261-16591283 CTCAGGAACATCCAGTACAAAGG - Intronic
1102729333 12:115094305-115094327 ATGACACACATCCAGTAAGAGGG - Intergenic
1105461731 13:20596556-20596578 ATGAGCCACACACAGTACTAAGG + Intronic
1108868351 13:54949806-54949828 GTCAGCCACATCCAGTTCCAAGG + Intergenic
1113003881 13:105677020-105677042 CTGAGGCACATCCTGTACCAAGG - Intergenic
1118391683 14:65301062-65301084 CTGGGCCACATGCAGTCCGTAGG - Intergenic
1119120809 14:72075080-72075102 CAAAGCCACATCCAGTATGGAGG - Intronic
1132909155 16:2299468-2299490 CTGAACCTCAACCTGTACGAGGG - Exonic
1133221244 16:4320023-4320045 CTGAGACTCTTCCAGTTCGATGG + Intronic
1141011613 16:80405655-80405677 CTGTGTCAAATCCAGAACGAGGG - Intergenic
1145404514 17:22574051-22574073 CAGTGCCACATCAAGTAAGATGG - Intergenic
1147914999 17:43880764-43880786 CTGAGCCCCAATCAGTACCAGGG + Exonic
1148998349 17:51731949-51731971 CTGTGCCAGATCCAGTGCTAAGG + Intronic
1149106644 17:52975372-52975394 CTGAGCCACATTCACTCCTAGGG + Intergenic
1151933887 17:77249475-77249497 CAGAGCCAGACCCAGAACGAGGG - Intergenic
1152364591 17:79848100-79848122 CTGAACCAGCTCCAGTACTATGG + Intergenic
1160812135 19:1017467-1017489 GTGAGCCACAGCCAGTGGGATGG - Intronic
1161330302 19:3683751-3683773 CAGAGGCACAGCCAGTACGGAGG + Intronic
1161515497 19:4693916-4693938 CAGAGCCACAGCCCGTACAAAGG - Intronic
1163683422 19:18696771-18696793 CTGAGCCCCCTCCAGTAGGGAGG + Intronic
927881860 2:26694584-26694606 CTGGGCCACATCCACTCCCAGGG - Intronic
929851966 2:45599710-45599732 CGCAGCCACATACAGTTCGAAGG - Exonic
930200242 2:48545784-48545806 CTGAGCCACATACATCACAAAGG - Intronic
933684740 2:85133796-85133818 CTGATCCCCTTCCAGGACGAGGG + Exonic
947982227 2:234420305-234420327 CTGAGCCTCATCCAATCCAAAGG - Intergenic
1179619791 21:42606336-42606358 CTGAGCCACCTCCAACACTATGG + Intergenic
1180921071 22:19521956-19521978 CTGGGCCACATCCAGTGGCAGGG - Intergenic
1182042669 22:27250577-27250599 CAGAGGCACAGCCAGTACAAAGG + Intergenic
1184104455 22:42359439-42359461 CTGAGCCACATCCTCTGGGAGGG - Intergenic
949277674 3:2304740-2304762 CTAAGCCACATACATTACAATGG + Intronic
950634381 3:14304512-14304534 CAGAGCCACATCCAGCTCCAAGG - Intergenic
956126879 3:66018943-66018965 CTGAGCCATATCCAATTGGAAGG + Intronic
957022549 3:75141316-75141338 CTCATGCACAGCCAGTACGACGG - Intergenic
962270487 3:133974653-133974675 CTGAGCCCCACCCAGAACCAGGG + Intronic
964499275 3:157330777-157330799 CCCAGCCACATCCAGAACCAAGG + Intronic
966500571 3:180634519-180634541 CTCAGCCACAACCACTACTAAGG + Intronic
971300057 4:25434376-25434398 ATGAGCCACAACCAGCCCGATGG - Intergenic
972195156 4:36645530-36645552 CTGCCCCACATCCAGAAGGAAGG + Intergenic
982286463 4:153741229-153741251 CAGAGCCTCATCCAATATGAGGG - Intronic
985588853 5:754656-754678 CTGAGGCTCATCCAGCACAAGGG - Intronic
985603534 5:847172-847194 CTGAGGCTCATCCAGCACAAGGG - Intronic
987695112 5:21318300-21318322 CTGGGCCACATCAAGCACCATGG + Intergenic
991507906 5:67343788-67343810 CTGATCCAGATCCAGCAAGAAGG - Intergenic
991745112 5:69731140-69731162 CTGGGCCACATCAAGCACCATGG - Intergenic
991752593 5:69824082-69824104 CTGGGCCACATCAAGCACCATGG + Intergenic
991796681 5:70310869-70310891 CTGGGCCACATCAAGCACCATGG - Intergenic
991802211 5:70380818-70380840 CTGGGCCACATCAAGCACCATGG + Intergenic
991824491 5:70606454-70606476 CTGGGCCACATCAAGCACCATGG - Intergenic
991831912 5:70699211-70699233 CTGGGCCACATCAAGCACCATGG + Intergenic
991889060 5:71310426-71310448 CTGGGCCACATCAAGCACCATGG - Intergenic
1005555778 6:26981549-26981571 CTGGGCCACATCAAGCACCATGG - Intergenic
1006010011 6:31034867-31034889 CTGAGCCACATCCATGGAGATGG + Exonic
1007976052 6:46102351-46102373 CTGTGCCACACCCAGAAGGAAGG - Intergenic
1008589472 6:52978891-52978913 CTGAGCCACATGCAGCCCGCGGG + Intronic
1019870786 7:3758933-3758955 CTGAGTCTAATCCAGTACCATGG + Intronic
1022969452 7:35504087-35504109 CTGCCCCACATCCAGAAGGAGGG - Intergenic
1029977676 7:104849777-104849799 CTGCCCCACATCCAGAAGGAAGG - Intronic
1036447460 8:8834403-8834425 CAGAGACACTTCCAGTACGCAGG + Intronic
1038961585 8:32526100-32526122 CTGAGCTACACCCAGTACCTTGG - Intronic
1039287231 8:36055193-36055215 CTGCCCCACATCCAGAAGGAAGG - Intergenic
1039333685 8:36566884-36566906 CTGCCCCACATCCAGAAAGAAGG - Intergenic
1048398547 8:134039660-134039682 CTCAGCCACAACCACTACTAAGG - Intergenic
1052345257 9:27402927-27402949 ATGAGCCATATACAGTACCATGG - Intronic
1062637254 9:137498203-137498225 GTGCGCCACACCCAGGACGACGG + Exonic
1187363965 X:18651553-18651575 CTGAGCCATACTCAGTCCGAGGG - Intronic
1192338003 X:70237986-70238008 CTGAGCCAAAACCGGTAGGAAGG - Intronic
1192956532 X:76076362-76076384 CTCAGCCACAACCACTACTAAGG + Intergenic
1196253934 X:113493838-113493860 CTGCCCCACATCCAGAAGGAAGG - Intergenic
1196314055 X:114202193-114202215 CTGCCCCACAGCCAGAACGAAGG - Intergenic
1198812794 X:140552521-140552543 TTCAGCCAAATCCAGTACGTGGG - Intergenic
1199249090 X:145638504-145638526 CTCAGCCACAAGCAGTACTAAGG + Intergenic
1199783675 X:151084801-151084823 CTGAGGCAGATCCAGGACCAAGG - Intergenic