ID: 1084102305

View in Genome Browser
Species Human (GRCh38)
Location 11:66957891-66957913
Sequence TGAGCCACATCCAGTACGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084102301_1084102305 5 Left 1084102301 11:66957863-66957885 CCTTACACGCCGCGGCTTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1084102305 11:66957891-66957913 TGAGCCACATCCAGTACGATGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1084102299_1084102305 11 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102305 11:66957891-66957913 TGAGCCACATCCAGTACGATGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1084102302_1084102305 -4 Left 1084102302 11:66957872-66957894 CCGCGGCTTCCTGCAGAGCTGAG 0: 1
1: 0
2: 17
3: 260
4: 4139
Right 1084102305 11:66957891-66957913 TGAGCCACATCCAGTACGATGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1084102300_1084102305 10 Left 1084102300 11:66957858-66957880 CCTCGCCTTACACGCCGCGGCTT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1084102305 11:66957891-66957913 TGAGCCACATCCAGTACGATGGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084102305 Original CRISPR TGAGCCACATCCAGTACGAT GGG Intronic
900756251 1:4437102-4437124 GGACCCTCATCCAGTAGGATTGG + Intergenic
907471975 1:54679925-54679947 TGAGCCACATCCAGGAGCCTCGG + Exonic
1079429923 11:20379664-20379686 TGAGGCCCATCCAGTACTCTGGG - Intronic
1084102305 11:66957891-66957913 TGAGCCACATCCAGTACGATGGG + Intronic
1088893564 11:114061779-114061801 TGAGTTACAACCAGTACGAAGGG - Intronic
1089572910 11:119422232-119422254 TGAGCCAGATCCAGGAGGAAGGG + Intronic
1095126749 12:38488173-38488195 TGAGCCAAATCTGGTATGATGGG - Intergenic
1097765032 12:63516284-63516306 TGTGCCAGATACAGTACGAAAGG + Intergenic
1104029917 12:125057660-125057682 TGAGCCACAGCCAGAATGACTGG - Intergenic
1105461732 13:20596557-20596579 TGAGCCACACACAGTACTAAGGG + Intronic
1133218798 16:4309379-4309401 TCAGCCACATCCAGCAAGACAGG - Intergenic
1139169701 16:64615632-64615654 TCTGCCACAGCCAGTATGATGGG + Intergenic
1148603651 17:48912164-48912186 TGAGCCACATCCTCCACAATAGG + Intronic
1149457268 17:56798035-56798057 TGAACCACCTTCAGTATGATAGG - Intronic
1156083449 18:33369376-33369398 TGAGCCAGATCCAGTAACAGTGG + Intronic
1160812134 19:1017466-1017488 TGAGCCACAGCCAGTGGGATGGG - Intronic
1161492876 19:4571866-4571888 TAACCGACATCCAGTAGGATGGG - Intergenic
1172099042 20:32474638-32474660 TGAGCCCCAGCCAGGACGAGAGG - Exonic
952851630 3:37734313-37734335 TGTGCCACATACATTACTATAGG - Intronic
954506530 3:51081475-51081497 TCAGCCACTTACAGTATGATAGG + Intronic
961928414 3:130508185-130508207 TGAGCCCAATCCAATACGACTGG + Intergenic
971300056 4:25434375-25434397 TGAGCCACAACCAGCCCGATGGG - Intergenic
979819908 4:125158292-125158314 TGAGCCACATTCAGTTTTATTGG - Intergenic
980220069 4:129902521-129902543 AGAACCACATCCAGCAAGATGGG - Intergenic
989049290 5:37303375-37303397 GGAGCCACATCTAGTCCGAATGG - Exonic
990154799 5:52863731-52863753 TTAGCCACATCAAGTACAGTAGG + Intronic
1007803147 6:44415306-44415328 TGAGCCATATGCAGTAAGTTTGG + Intronic
1016087152 6:139927923-139927945 TAAGCCCCAGCCAGTACTATAGG - Intergenic
1019870787 7:3758934-3758956 TGAGTCTAATCCAGTACCATGGG + Intronic
1025261672 7:57424606-57424628 TGTTCCACATCCTGTACGACCGG + Intergenic
1035861738 8:3036414-3036436 TTACCCACATTGAGTACGATAGG - Intronic
1039308819 8:36293601-36293623 GGAGCCACATTCAATACCATAGG + Intergenic
1049537126 8:143187670-143187692 GGTGCCACCTCCAGTAGGATGGG - Intergenic
1052345256 9:27402926-27402948 TGAGCCATATACAGTACCATGGG - Intronic
1186204077 X:7182960-7182982 TGGGCCCCATCCAATATGATTGG + Intergenic
1192784469 X:74323186-74323208 TGAGCCTCATCCAGAACTTTTGG - Intergenic
1193134396 X:77953921-77953943 TGAGACACATGCAGTGCTATAGG + Intronic