ID: 1084102306

View in Genome Browser
Species Human (GRCh38)
Location 11:66957892-66957914
Sequence GAGCCACATCCAGTACGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084102300_1084102306 11 Left 1084102300 11:66957858-66957880 CCTCGCCTTACACGCCGCGGCTT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1084102306 11:66957892-66957914 GAGCCACATCCAGTACGATGGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1084102301_1084102306 6 Left 1084102301 11:66957863-66957885 CCTTACACGCCGCGGCTTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1084102306 11:66957892-66957914 GAGCCACATCCAGTACGATGGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1084102299_1084102306 12 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102306 11:66957892-66957914 GAGCCACATCCAGTACGATGGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1084102302_1084102306 -3 Left 1084102302 11:66957872-66957894 CCGCGGCTTCCTGCAGAGCTGAG 0: 1
1: 0
2: 17
3: 260
4: 4139
Right 1084102306 11:66957892-66957914 GAGCCACATCCAGTACGATGGGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084102306 Original CRISPR GAGCCACATCCAGTACGATG GGG Intronic
903569581 1:24294457-24294479 GTGGCACATCCAGTACGAAGAGG - Intergenic
905325830 1:37151422-37151444 GAGCCCCATCAATTATGATGGGG - Intergenic
905369471 1:37475378-37475400 AAACCACATCCAGCAGGATGAGG - Intronic
910203798 1:84726868-84726890 GGGCCTCATCCAGTCAGATGAGG - Intergenic
920041008 1:203097237-203097259 GACCCTCATCCAGAAAGATGTGG + Intronic
921360661 1:214328777-214328799 CAGCTAAATCCATTACGATGAGG + Intronic
921397945 1:214688860-214688882 GGGCAACATCCAGTACATTGAGG - Intergenic
921945457 1:220883138-220883160 GAGCCAGAGCCAGTGCTATGGGG - Intronic
1064156734 10:12909002-12909024 GAGCCCCATCCACTGTGATGTGG - Intronic
1067809226 10:49414237-49414259 GACCCAAGTCCAGCACGATGTGG + Intergenic
1070285870 10:75083321-75083343 GGGCCACATCCAGTAGGAGGAGG - Intergenic
1075637713 10:124041080-124041102 GAGTCACCTCCAGTATGATTTGG - Intronic
1076632968 10:131862951-131862973 GACTCACATCCAGGAGGATGGGG + Intergenic
1078373464 11:10772538-10772560 GAGCCAGGCCCAGTACCATGTGG + Exonic
1081626230 11:44656926-44656948 GAGCCACAGTCAATAAGATGTGG + Intergenic
1084102306 11:66957892-66957914 GAGCCACATCCAGTACGATGGGG + Intronic
1088220272 11:107563323-107563345 GAGCCTCATTCAGTGCTATGAGG + Intronic
1089572911 11:119422233-119422255 GAGCCAGATCCAGGAGGAAGGGG + Intronic
1096602113 12:52736721-52736743 GAACCACATCCACTGCGGTGGGG + Intergenic
1101353814 12:103957619-103957641 GAGCCACATCCAGACAGCTGTGG + Intronic
1108283673 13:48884406-48884428 GAATCACTTCCAGTACTATGTGG - Intergenic
1108548403 13:51519465-51519487 GTGTCACATCCAGTAATATGGGG - Intergenic
1108631705 13:52289946-52289968 GAGCCACATCCAACAAGATCAGG + Intergenic
1108654985 13:52522649-52522671 GAGCCACATCCAACAAGATCAGG - Intergenic
1135734435 16:24919541-24919563 GGGTCACATCCAGTTTGATGAGG + Exonic
1143545244 17:7591577-7591599 AAGGCACATCCAGTCTGATGGGG + Exonic
1146263753 17:31437909-31437931 GAGCCACATCCAGTAAGGTCAGG - Intronic
1151632272 17:75319004-75319026 AAGCCAGATCCAGTGGGATGTGG + Exonic
1154059669 18:11047512-11047534 GAGCCACATCCACAACAAAGAGG + Intronic
1157511619 18:48279437-48279459 TAGGCAGATCCAGTAAGATGTGG + Intronic
1159061482 18:63519204-63519226 GAGCCACATCAGGTAAGTTGGGG - Intergenic
1160812133 19:1017465-1017487 GAGCCACAGCCAGTGGGATGGGG - Intronic
1161492875 19:4571865-4571887 AACCGACATCCAGTAGGATGGGG - Intergenic
1161727011 19:5935362-5935384 GAGCCAGATCCTGCAGGATGCGG + Intronic
929807293 2:45158023-45158045 GATCCAAATCCAGGACTATGAGG - Intergenic
935560029 2:104550063-104550085 TAACCACATGCAGTAAGATGTGG - Intergenic
940117952 2:150230605-150230627 GTGCCAGATCATGTACGATGTGG + Intergenic
941812410 2:169768040-169768062 AAGCCACATCCAGTACCAGCAGG - Intronic
1172667376 20:36609878-36609900 GAGCCACATCCCAGAAGATGTGG + Intronic
1173367748 20:42402578-42402600 GACCCACATCCAATAATATGCGG + Intronic
1183531983 22:38361523-38361545 GAGTGACATCCAGTAAGACGAGG + Intronic
1184403630 22:44287740-44287762 CAGCCCCATCCAGTATGCTGGGG + Intronic
954671218 3:52292265-52292287 GAGCCTCATCCTGTCAGATGTGG + Exonic
968862074 4:3180630-3180652 GAGACTCATCCAGTACCATCAGG + Exonic
968907452 4:3461267-3461289 GAGCCACATCCTGAAAGAGGAGG - Intergenic
970021451 4:11574075-11574097 AAGCCACATGCAGTATGAGGTGG - Intergenic
980875557 4:138658717-138658739 GAGCCACAGGCAGCATGATGAGG - Intergenic
997089515 5:130840934-130840956 TAGCAACATCCAGCATGATGTGG - Intergenic
997828281 5:137127257-137127279 GAGCCACAGTGAGTACTATGAGG + Intronic
1000050918 5:157562325-157562347 GAACCACATCCAGCCCCATGCGG + Intronic
1002882820 6:1267924-1267946 AAGCCACATCGAGGAAGATGTGG + Intergenic
1013349078 6:109290036-109290058 AAGCCAGATCCAGTACGAGCAGG - Intergenic
1013375377 6:109509609-109509631 TAGCCACACCCAGGAGGATGAGG - Intronic
1018146331 6:160893312-160893334 GAGCCACATCCTGAACAATCAGG - Intergenic
1019870788 7:3758935-3758957 GAGTCTAATCCAGTACCATGGGG + Intronic
1024015724 7:45312342-45312364 GGGCCAGATTCAGTATGATGGGG + Intergenic
1029291653 7:99506203-99506225 CAGGCACTTCCAGTACCATGAGG + Exonic
1035917688 8:3643166-3643188 GAGCCACATCCAGGAAGCTCAGG + Intronic
1037550496 8:19966425-19966447 GAGCCAGATGGAGTACCATGAGG + Exonic
1055088396 9:72337597-72337619 GAGCCACATCCGGAATGAAGTGG - Intergenic
1056558607 9:87710344-87710366 GACCCAAAGCCAGTACGGTGTGG + Intergenic
1058596397 9:106620630-106620652 GAGCCAGATCCAGTCGGAAGGGG + Intergenic
1062256399 9:135624429-135624451 CAGTCACATCCAGGACGAGGTGG - Exonic
1190961829 X:55258093-55258115 CAGACTCATCCAGTACAATGTGG - Intronic
1196238780 X:113315188-113315210 GAGCCACATCAAGTAATATCAGG + Intergenic
1199591075 X:149469017-149469039 CAGCCACTTCCAGGATGATGAGG - Intergenic
1200073793 X:153541480-153541502 CAGCCACCTCCAGGATGATGAGG - Exonic