ID: 1084102309

View in Genome Browser
Species Human (GRCh38)
Location 11:66957901-66957923
Sequence CCAGTACGATGGGGACAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084102302_1084102309 6 Left 1084102302 11:66957872-66957894 CCGCGGCTTCCTGCAGAGCTGAG 0: 1
1: 0
2: 17
3: 260
4: 4139
Right 1084102309 11:66957901-66957923 CCAGTACGATGGGGACAACTTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1084102301_1084102309 15 Left 1084102301 11:66957863-66957885 CCTTACACGCCGCGGCTTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1084102309 11:66957901-66957923 CCAGTACGATGGGGACAACTTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1084102303_1084102309 -3 Left 1084102303 11:66957881-66957903 CCTGCAGAGCTGAGCCACATCCA 0: 1
1: 0
2: 3
3: 10
4: 223
Right 1084102309 11:66957901-66957923 CCAGTACGATGGGGACAACTTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1084102299_1084102309 21 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102309 11:66957901-66957923 CCAGTACGATGGGGACAACTTGG 0: 1
1: 0
2: 1
3: 6
4: 55
1084102300_1084102309 20 Left 1084102300 11:66957858-66957880 CCTCGCCTTACACGCCGCGGCTT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1084102309 11:66957901-66957923 CCAGTACGATGGGGACAACTTGG 0: 1
1: 0
2: 1
3: 6
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084102309 Original CRISPR CCAGTACGATGGGGACAACT TGG Intronic
900226497 1:1535754-1535776 CCCGTACGACGGGGACCAGTCGG - Exonic
900835462 1:5000171-5000193 CCAGCAGGATGGGTACAACACGG - Intergenic
913124220 1:115770414-115770436 CCAGTGAGATCGAGACAACTGGG - Intergenic
1074527532 10:114275211-114275233 CCAGTAAGGTGGGGACATCCAGG + Intronic
1079464726 11:20718759-20718781 CCAGTACGATGAGGAGAACGAGG + Intronic
1084102309 11:66957901-66957923 CCAGTACGATGGGGACAACTTGG + Intronic
1087596966 11:100266364-100266386 CCAGAACTTTAGGGACAACTTGG - Intronic
1102504605 12:113375726-113375748 CCAGGGTGATGGGGACAGCTGGG + Intronic
1106731512 13:32545880-32545902 CCAGGGAGAGGGGGACAACTAGG + Intergenic
1112776009 13:102844991-102845013 CCAGAAAGGTGGGGACAACTCGG + Exonic
1124411382 15:29440524-29440546 CCAGTAAGATGTGGAAACCTGGG - Intronic
1127155598 15:56122140-56122162 CCAGTAGGATGGGTACAAACAGG - Intronic
1130637866 15:85642429-85642451 TCAGTAGGAAGGGGACAAATAGG + Intronic
1131441685 15:92464364-92464386 CCAGTGCGATGGGGCCACGTAGG + Exonic
1131642896 15:94311860-94311882 TCAGTACAGTGAGGACAACTTGG + Intronic
1138655744 16:58490323-58490345 CCAGTACAATGGGGAGAACTAGG + Intronic
1144007994 17:11118676-11118698 CCAGTGTCTTGGGGACAACTTGG + Intergenic
1144423666 17:15120934-15120956 CCAGAAGGATGGGGATCACTGGG + Intergenic
1147338595 17:39740912-39740934 CCAGTACTATGAGGCCACCTGGG - Intronic
1163602898 19:18259342-18259364 ACAGAACCAGGGGGACAACTGGG + Intronic
1163752703 19:19087581-19087603 CAAGAACCATGGGGACAGCTGGG - Intronic
1165107006 19:33476398-33476420 TCACTGAGATGGGGACAACTGGG - Intronic
928491509 2:31788660-31788682 CCTGTACTTTGAGGACAACTTGG - Intergenic
932940706 2:76161418-76161440 CTAGTAAGATGGGGACTAATGGG - Intergenic
933736872 2:85502405-85502427 CCAGTACTATGTGCACAACACGG - Intergenic
937547065 2:123035900-123035922 CCATTACGATGGAGAGAAATTGG + Intergenic
940637258 2:156313336-156313358 CCAGAACGATGTTGACAAATTGG - Intergenic
943852206 2:192738334-192738356 CCAGTTCGAGGGAGAGAACTGGG + Intergenic
946023043 2:216654931-216654953 CCAGGAGGCTGGGGTCAACTTGG - Intronic
1170159851 20:13299696-13299718 GCAGAAGGATGGGGACAACTTGG + Exonic
1182423217 22:30258403-30258425 TCTGTACAATGGGGCCAACTTGG - Intergenic
951779306 3:26345700-26345722 TCAGTACGATGTGAACAAATGGG + Intergenic
953889718 3:46742957-46742979 CCAGGACAAGGGGGACAACTGGG + Exonic
954367196 3:50152465-50152487 ACTGTACAATGGGGACAACAGGG + Intergenic
956458687 3:69450015-69450037 CCAGTAAAATGGGGAGAACAAGG + Intronic
956458695 3:69450060-69450082 CCAGTAAAATGGGGAGAACGAGG + Intronic
961346895 3:126268739-126268761 GCAGGCAGATGGGGACAACTGGG + Intergenic
961539316 3:127589561-127589583 CCAGTAAGATGGGGAGGCCTGGG + Intronic
964828140 3:160852242-160852264 CCAGGACGATCAGGACAACTAGG + Intronic
980209534 4:129768697-129768719 CTAGTACAATGAGTACAACTAGG + Intergenic
981090108 4:140723382-140723404 CCAGTACAATGGCGTCATCTGGG + Intronic
982245950 4:153350829-153350851 CCAGTAGACTGGGGCCAACTAGG - Intronic
987992062 5:25225749-25225771 CCAGTATAATGGGTACTACTAGG - Intergenic
996805070 5:127445563-127445585 CCAGTAGGAAGAGAACAACTAGG - Exonic
1000960547 5:167596345-167596367 CCAGTAGGATGGAGAGAACAGGG - Intronic
1010775398 6:79879146-79879168 CCAGTAGGATGGTGCCAACAAGG + Intergenic
1015272701 6:131353792-131353814 CCAGTCAGATGGGCACAAATGGG + Intergenic
1016392304 6:143586746-143586768 CCAGTACCATGGCAACACCTGGG - Intronic
1016591717 6:145753010-145753032 CCAGCCTCATGGGGACAACTTGG + Intergenic
1020065272 7:5183540-5183562 TCAGTTCCATGGGGACAATTGGG - Intergenic
1024620171 7:51150150-51150172 ACAGAACGATGGGTACACCTTGG + Intronic
1029944223 7:104514738-104514760 CCAGTTAAATGGGGACATCTTGG - Intronic
1038998794 8:32956338-32956360 CCAATAGGATGGGGAAAACTTGG + Intergenic
1042196922 8:66238660-66238682 CCAGGTCCATGGTGACAACTTGG + Intergenic
1046799771 8:118413072-118413094 CCAGTATGTTGGGAACAATTGGG - Intronic
1056795027 9:89652714-89652736 CCAGTAAGATAGGGATAAATTGG - Intergenic
1059307816 9:113368401-113368423 CCAGGACCATTAGGACAACTGGG + Intronic
1060010128 9:120036619-120036641 AAAGTGCAATGGGGACAACTGGG - Intergenic
1060664745 9:125426108-125426130 CCTGTTCTATGGGGCCAACTTGG + Intergenic
1203372105 Un_KI270442v1:317165-317187 CCTGTACGATGGAGCCAACCTGG + Intergenic
1188414323 X:29914091-29914113 ACAGTGCTATGGGGACACCTAGG - Intronic
1197200818 X:123747166-123747188 CCAGGAAAATTGGGACAACTTGG - Intergenic
1198283885 X:135171175-135171197 CCAGGCCGGTGGTGACAACTGGG - Exonic