ID: 1084102310

View in Genome Browser
Species Human (GRCh38)
Location 11:66957902-66957924
Sequence CAGTACGATGGGGACAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084102300_1084102310 21 Left 1084102300 11:66957858-66957880 CCTCGCCTTACACGCCGCGGCTT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1084102310 11:66957902-66957924 CAGTACGATGGGGACAACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 95
1084102299_1084102310 22 Left 1084102299 11:66957857-66957879 CCCTCGCCTTACACGCCGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1084102310 11:66957902-66957924 CAGTACGATGGGGACAACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 95
1084102303_1084102310 -2 Left 1084102303 11:66957881-66957903 CCTGCAGAGCTGAGCCACATCCA 0: 1
1: 0
2: 3
3: 10
4: 223
Right 1084102310 11:66957902-66957924 CAGTACGATGGGGACAACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 95
1084102302_1084102310 7 Left 1084102302 11:66957872-66957894 CCGCGGCTTCCTGCAGAGCTGAG 0: 1
1: 0
2: 17
3: 260
4: 4139
Right 1084102310 11:66957902-66957924 CAGTACGATGGGGACAACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 95
1084102301_1084102310 16 Left 1084102301 11:66957863-66957885 CCTTACACGCCGCGGCTTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1084102310 11:66957902-66957924 CAGTACGATGGGGACAACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084102310 Original CRISPR CAGTACGATGGGGACAACTT GGG Intronic
900717914 1:4156983-4157005 GATTAGGATGGGGACATCTTTGG - Intergenic
907247172 1:53115701-53115723 CTGTAAAATGGGGACATCTTGGG + Intronic
907681124 1:56564879-56564901 CAGTAAGTTGGTAACAACTTTGG + Intronic
910932970 1:92460739-92460761 CAGAATGATGGTTACAACTTTGG - Intergenic
911981659 1:104576798-104576820 CAGTAAGCTGGGGAAATCTTAGG - Intergenic
912959100 1:114179508-114179530 GATTAGGATGGGGACATCTTTGG - Intergenic
914391166 1:147224600-147224622 CAGGAGGATGGGGTGAACTTGGG - Intronic
1065464347 10:26002845-26002867 CAGGGCGTTGGGGAAAACTTGGG - Intronic
1070744690 10:78926647-78926669 CAGTAGGATGGGGAGAACAATGG - Intergenic
1074440337 10:113472235-113472257 AAGTAAGATGGGGACATCTAAGG + Intergenic
1074845096 10:117390775-117390797 GATTAGGATGTGGACAACTTTGG - Intergenic
1077632017 11:3817325-3817347 CAGCACGAGGGATACAACTTGGG - Intronic
1079464727 11:20718760-20718782 CAGTACGATGAGGAGAACGAGGG + Intronic
1083087551 11:60165863-60165885 GAGTAGGATGTGGATAACTTTGG - Intergenic
1084102310 11:66957902-66957924 CAGTACGATGGGGACAACTTGGG + Intronic
1092293158 12:7177185-7177207 CAGTACGACGTGGACATCTTTGG - Intergenic
1097445545 12:59667337-59667359 CAGTAAGATGTGGAAAAGTTTGG + Intronic
1102952841 12:117041799-117041821 CAGTAGGAAGGGGTCAACCTGGG - Intronic
1103414398 12:120734253-120734275 GATTAGGATGGGGACATCTTGGG + Intronic
1106009364 13:25803710-25803732 CAGTTTGATGTGGAGAACTTAGG - Intronic
1106139845 13:27003046-27003068 GAGTAGGAGGGGGACATCTTTGG - Intergenic
1107565500 13:41599766-41599788 CATTGCAATGGGGCCAACTTTGG + Intronic
1108111915 13:47082657-47082679 GAGTAGGATGTGGACAATTTGGG + Intergenic
1108705047 13:52977766-52977788 CAGTCTGATGGGGACAGCTGTGG - Intergenic
1111902708 13:94219422-94219444 CAGAATGATGGGGAAAAGTTGGG - Intronic
1113096569 13:106671454-106671476 CAGTACGATGGTGACACAGTAGG - Intergenic
1115289348 14:31752616-31752638 CAGGAAGATGTGGAAAACTTTGG - Intronic
1126942531 15:53781904-53781926 CAGAACGATGTGGATAAGTTTGG - Intergenic
1128929388 15:71690524-71690546 GAGTAGGCTGTGGACAACTTTGG - Intronic
1131311253 15:91292455-91292477 CAGAAGGATGGGGACCACTTTGG - Exonic
1131642897 15:94311861-94311883 CAGTACAGTGAGGACAACTTGGG + Intronic
1136500049 16:30665486-30665508 CAGGAGGATGGGCACGACTTTGG - Intronic
1138639856 16:58376709-58376731 CGGTACTTTGGGGACAACTGAGG - Intronic
1138655745 16:58490324-58490346 CAGTACAATGGGGAGAACTAGGG + Intronic
1140264535 16:73408868-73408890 CTGGAAGATGAGGACAACTTCGG - Intergenic
1141235627 16:82213347-82213369 GATTAGGATGTGGACAACTTTGG - Intergenic
1144005568 17:11096165-11096187 AATTAGGATGGGGACATCTTTGG - Intergenic
1145830356 17:27911258-27911280 CAGAGCCATGTGGACAACTTTGG + Intergenic
1148381549 17:47202429-47202451 AAGTATGCTTGGGACAACTTAGG - Intronic
1157133498 18:45031335-45031357 AATTACGATGTGGACAGCTTTGG + Intronic
924993560 2:337299-337321 CAGGAAGATGTGGAAAACTTTGG + Intergenic
931097225 2:58954932-58954954 CAGTAAAATAGGGACACCTTTGG - Intergenic
933445652 2:82377068-82377090 CAGGAAGATGTGGACAAGTTTGG + Intergenic
938078727 2:128357692-128357714 CAGTCTGATGGGACCAACTTAGG + Intergenic
939001787 2:136745114-136745136 CAGTAAAATGGGGACAACAGTGG + Intergenic
1169285366 20:4303139-4303161 CAGTGTGATGGGGACACCCTGGG + Intergenic
1173426653 20:42948999-42949021 CAGTGGGATGAGGACAACATGGG - Intronic
1176968221 21:15235761-15235783 CACTACGATGGGAACAGCATGGG - Intergenic
1177802177 21:25838862-25838884 GATTACGATGTGGACATCTTGGG + Intergenic
1183125140 22:35771096-35771118 GATTAGGATGTGGACAACTTTGG - Intronic
949767785 3:7546350-7546372 CAGTAGGATGGGGACTACTAAGG + Intronic
951106292 3:18747050-18747072 CAGTAGGACTAGGACAACTTGGG + Intergenic
953889719 3:46742958-46742980 CAGGACAAGGGGGACAACTGGGG + Exonic
956754435 3:72371090-72371112 CGGCAAGATGGGGACCACTTTGG - Intergenic
958517886 3:95143774-95143796 TAGTACAATGATGACAACTTTGG + Intergenic
959533331 3:107458260-107458282 CAGTTCCATAGGGACCACTTTGG + Intergenic
960938074 3:122915539-122915561 CACTTGGATGGGGACAACTCAGG - Exonic
963539023 3:146563146-146563168 CAGAAAGATGTGGAAAACTTTGG - Intergenic
965491720 3:169345380-169345402 CAGTAAAATGGGAAAAACTTGGG - Intronic
967566484 3:190979314-190979336 CAGGAAGATGTGGAAAACTTTGG + Intergenic
968750022 4:2383973-2383995 CAGGGTGATGGGGACATCTTAGG - Intronic
970398059 4:15690947-15690969 CAGTAGGATGTAGACATCTTTGG + Intronic
973367641 4:49220653-49220675 CAGGAAGATGAGGAAAACTTTGG - Intergenic
973599689 4:52529638-52529660 CAGTAGGATGTGGACATCTCTGG - Intergenic
981912427 4:149997032-149997054 CATTAAGATGTGGACAACTTTGG - Intergenic
982693415 4:158572814-158572836 CAGGCCGATGAGGACAACTGTGG + Exonic
983041604 4:162934669-162934691 CATCATAATGGGGACAACTTGGG + Intergenic
984552946 4:181182493-181182515 AATTAGGATGGGGACATCTTGGG - Intergenic
990049515 5:51480155-51480177 CAGTCAGATGGGGACAAGGTGGG + Intergenic
990855973 5:60266749-60266771 CAGAAAGATGGGTATAACTTGGG - Intronic
997460160 5:134046556-134046578 CATTAGGATGTGGACATCTTGGG + Intergenic
1001172166 5:169429828-169429850 CAGTCCAATGGGGACAAGATGGG + Intergenic
1001218300 5:169876294-169876316 CTGTAGGATGTGGACACCTTAGG + Intronic
1003439162 6:6123253-6123275 CAGAAAGATGAGGACAATTTTGG + Intergenic
1003984747 6:11424653-11424675 CAGCCCAGTGGGGACAACTTCGG + Intergenic
1005122057 6:22400864-22400886 CAGTACCATGGGGATAGCTTAGG + Intergenic
1005464713 6:26101242-26101264 CAGTACCATTGGCACACCTTTGG - Intergenic
1013957892 6:115861571-115861593 CAGTATCATGAGGACAGCTTGGG - Intergenic
1018772454 6:166983256-166983278 GATTAGGATGGGGACATCTTTGG + Intergenic
1020729972 7:11868407-11868429 CACTACCATGAGGACAACATGGG - Intergenic
1022439646 7:30422957-30422979 GAGTGAGAAGGGGACAACTTGGG + Intergenic
1023266745 7:38414270-38414292 CATTATTCTGGGGACAACTTTGG - Intronic
1023570923 7:41571101-41571123 CAGTATGATGGGTACATATTGGG + Intergenic
1024620172 7:51150151-51150173 CAGAACGATGGGTACACCTTGGG + Intronic
1029666378 7:101997709-101997731 CTGTACAATGGGCACAACATCGG - Intronic
1031818462 7:126469927-126469949 CAGGACGATGTGGGAAACTTTGG + Intronic
1035952319 8:4036348-4036370 CAGTACCATGGTAACAATTTTGG - Intronic
1037035361 8:14159795-14159817 CACTGCGATGGGGTCAGCTTTGG - Intronic
1037610174 8:20469488-20469510 CAGCAGTATGGGGAAAACTTAGG - Intergenic
1038813059 8:30871251-30871273 GAGTAGGATGTGGACATCTTTGG + Intronic
1042196923 8:66238661-66238683 CAGGTCCATGGTGACAACTTGGG + Intergenic
1044243076 8:89909616-89909638 CAATACTTTGGTGACAACTTGGG + Exonic
1049362983 8:142221261-142221283 CAGAAGGGTGGGGACAACTGTGG - Intronic
1053277093 9:36791295-36791317 CAGTCTGATGGGGTCAGCTTAGG + Intergenic
1056795026 9:89652713-89652735 CAGTAAGATAGGGATAAATTGGG - Intergenic
1056983825 9:91342426-91342448 CATTAGGACGTGGACAACTTTGG + Intronic
1058744580 9:107977300-107977322 GAGTACTATGGGAAAAACTTAGG - Intergenic
1060010127 9:120036618-120036640 AAGTGCAATGGGGACAACTGGGG - Intergenic
1186641982 X:11465662-11465684 AAGTACGTTTGGAACAACTTGGG - Intronic
1191715898 X:64193284-64193306 CATGATGATGGGGACAACTGAGG + Exonic
1193845716 X:86467462-86467484 CAGGAAGATGGGGAAAAGTTTGG - Intronic
1196627530 X:117893674-117893696 CAGTCTGATGGAGTCAACTTAGG - Intergenic
1198236591 X:134741334-134741356 TAGTACGGTGAGGAGAACTTTGG + Intronic
1199076810 X:143534695-143534717 CAGCACTCTTGGGACAACTTGGG - Intergenic