ID: 1084106279

View in Genome Browser
Species Human (GRCh38)
Location 11:66982951-66982973
Sequence CCAGCTCAGTCTGGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106279_1084106294 25 Left 1084106279 11:66982951-66982973 CCTGCTCCCCCAGACTGAGCTGG No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106279_1084106291 17 Left 1084106279 11:66982951-66982973 CCTGCTCCCCCAGACTGAGCTGG No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106279_1084106292 18 Left 1084106279 11:66982951-66982973 CCTGCTCCCCCAGACTGAGCTGG No data
Right 1084106292 11:66982992-66983014 GAATCCTGGCTTCGTCCCCAGGG No data
1084106279_1084106287 4 Left 1084106279 11:66982951-66982973 CCTGCTCCCCCAGACTGAGCTGG No data
Right 1084106287 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106279 Original CRISPR CCAGCTCAGTCTGGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr