ID: 1084106282

View in Genome Browser
Species Human (GRCh38)
Location 11:66982958-66982980
Sequence AGGGAGACCAGCTCAGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106282_1084106291 10 Left 1084106282 11:66982958-66982980 CCCCAGACTGAGCTGGTCTCCCT No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106282_1084106294 18 Left 1084106282 11:66982958-66982980 CCCCAGACTGAGCTGGTCTCCCT No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106282_1084106292 11 Left 1084106282 11:66982958-66982980 CCCCAGACTGAGCTGGTCTCCCT No data
Right 1084106292 11:66982992-66983014 GAATCCTGGCTTCGTCCCCAGGG No data
1084106282_1084106287 -3 Left 1084106282 11:66982958-66982980 CCCCAGACTGAGCTGGTCTCCCT No data
Right 1084106287 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106282 Original CRISPR AGGGAGACCAGCTCAGTCTG GGG (reversed) Intergenic
No off target data available for this crispr