ID: 1084106285

View in Genome Browser
Species Human (GRCh38)
Location 11:66982977-66982999
Sequence CAGGATTCTGGGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106285_1084106306 24 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106306 11:66983024-66983046 CTTAGACATCGGGTGTGGAGGGG No data
1084106285_1084106303 19 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106303 11:66983019-66983041 AGGCACTTAGACATCGGGTGTGG No data
1084106285_1084106299 14 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106299 11:66983014-66983036 GCCCCAGGCACTTAGACATCGGG No data
1084106285_1084106292 -8 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106292 11:66982992-66983014 GAATCCTGGCTTCGTCCCCAGGG No data
1084106285_1084106298 13 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106285_1084106305 23 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106285_1084106304 22 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106304 11:66983022-66983044 CACTTAGACATCGGGTGTGGAGG No data
1084106285_1084106291 -9 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106285_1084106294 -1 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106285_1084106307 25 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106307 11:66983025-66983047 TTAGACATCGGGTGTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106285 Original CRISPR CAGGATTCTGGGAAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr