ID: 1084106286

View in Genome Browser
Species Human (GRCh38)
Location 11:66982978-66983000
Sequence CCAGGATTCTGGGAAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106286_1084106291 -10 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106286_1084106307 24 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106307 11:66983025-66983047 TTAGACATCGGGTGTGGAGGGGG No data
1084106286_1084106305 22 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106286_1084106298 12 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106286_1084106294 -2 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106286_1084106304 21 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106304 11:66983022-66983044 CACTTAGACATCGGGTGTGGAGG No data
1084106286_1084106303 18 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106303 11:66983019-66983041 AGGCACTTAGACATCGGGTGTGG No data
1084106286_1084106299 13 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106299 11:66983014-66983036 GCCCCAGGCACTTAGACATCGGG No data
1084106286_1084106292 -9 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106292 11:66982992-66983014 GAATCCTGGCTTCGTCCCCAGGG No data
1084106286_1084106306 23 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106306 11:66983024-66983046 CTTAGACATCGGGTGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106286 Original CRISPR CCAGGATTCTGGGAAGGTGA AGG (reversed) Intergenic
No off target data available for this crispr