ID: 1084106290

View in Genome Browser
Species Human (GRCh38)
Location 11:66982989-66983011
Sequence TGGGGACGAAGCCAGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106290_1084106306 12 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106306 11:66983024-66983046 CTTAGACATCGGGTGTGGAGGGG No data
1084106290_1084106304 10 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106304 11:66983022-66983044 CACTTAGACATCGGGTGTGGAGG No data
1084106290_1084106305 11 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106290_1084106298 1 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106290_1084106309 24 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106309 11:66983036-66983058 GTGTGGAGGGGGTTCAATGGTGG No data
1084106290_1084106308 21 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106308 11:66983033-66983055 CGGGTGTGGAGGGGGTTCAATGG No data
1084106290_1084106307 13 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106307 11:66983025-66983047 TTAGACATCGGGTGTGGAGGGGG No data
1084106290_1084106303 7 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106303 11:66983019-66983041 AGGCACTTAGACATCGGGTGTGG No data
1084106290_1084106299 2 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106299 11:66983014-66983036 GCCCCAGGCACTTAGACATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106290 Original CRISPR TGGGGACGAAGCCAGGATTC TGG (reversed) Intergenic
No off target data available for this crispr