ID: 1084106291

View in Genome Browser
Species Human (GRCh38)
Location 11:66982991-66983013
Sequence AGAATCCTGGCTTCGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106285_1084106291 -9 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106286_1084106291 -10 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106279_1084106291 17 Left 1084106279 11:66982951-66982973 CCTGCTCCCCCAGACTGAGCTGG No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106277_1084106291 23 Left 1084106277 11:66982945-66982967 CCCTCTCCTGCTCCCCCAGACTG No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106284_1084106291 8 Left 1084106284 11:66982960-66982982 CCAGACTGAGCTGGTCTCCCTTC No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106278_1084106291 22 Left 1084106278 11:66982946-66982968 CCTCTCCTGCTCCCCCAGACTGA No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106282_1084106291 10 Left 1084106282 11:66982958-66982980 CCCCAGACTGAGCTGGTCTCCCT No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106281_1084106291 11 Left 1084106281 11:66982957-66982979 CCCCCAGACTGAGCTGGTCTCCC No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data
1084106283_1084106291 9 Left 1084106283 11:66982959-66982981 CCCAGACTGAGCTGGTCTCCCTT No data
Right 1084106291 11:66982991-66983013 AGAATCCTGGCTTCGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106291 Original CRISPR AGAATCCTGGCTTCGTCCCC AGG Intergenic
No off target data available for this crispr