ID: 1084106294

View in Genome Browser
Species Human (GRCh38)
Location 11:66982999-66983021
Sequence GGCTTCGTCCCCAGGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106284_1084106294 16 Left 1084106284 11:66982960-66982982 CCAGACTGAGCTGGTCTCCCTTC No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106278_1084106294 30 Left 1084106278 11:66982946-66982968 CCTCTCCTGCTCCCCCAGACTGA No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106283_1084106294 17 Left 1084106283 11:66982959-66982981 CCCAGACTGAGCTGGTCTCCCTT No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106288_1084106294 -8 Left 1084106288 11:66982984-66983006 CCTTCCCAGAATCCTGGCTTCGT No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106286_1084106294 -2 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106282_1084106294 18 Left 1084106282 11:66982958-66982980 CCCCAGACTGAGCTGGTCTCCCT No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106281_1084106294 19 Left 1084106281 11:66982957-66982979 CCCCCAGACTGAGCTGGTCTCCC No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106279_1084106294 25 Left 1084106279 11:66982951-66982973 CCTGCTCCCCCAGACTGAGCTGG No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data
1084106285_1084106294 -1 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106294 11:66982999-66983021 GGCTTCGTCCCCAGGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106294 Original CRISPR GGCTTCGTCCCCAGGGCCCC AGG Intergenic
No off target data available for this crispr