ID: 1084106298

View in Genome Browser
Species Human (GRCh38)
Location 11:66983013-66983035
Sequence GGCCCCAGGCACTTAGACAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106288_1084106298 6 Left 1084106288 11:66982984-66983006 CCTTCCCAGAATCCTGGCTTCGT No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106289_1084106298 2 Left 1084106289 11:66982988-66983010 CCCAGAATCCTGGCTTCGTCCCC No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106284_1084106298 30 Left 1084106284 11:66982960-66982982 CCAGACTGAGCTGGTCTCCCTTC No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106285_1084106298 13 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106290_1084106298 1 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106286_1084106298 12 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data
1084106293_1084106298 -6 Left 1084106293 11:66982996-66983018 CCTGGCTTCGTCCCCAGGGCCCC No data
Right 1084106298 11:66983013-66983035 GGCCCCAGGCACTTAGACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106298 Original CRISPR GGCCCCAGGCACTTAGACAT CGG Intergenic
No off target data available for this crispr