ID: 1084106305

View in Genome Browser
Species Human (GRCh38)
Location 11:66983023-66983045
Sequence ACTTAGACATCGGGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084106285_1084106305 23 Left 1084106285 11:66982977-66982999 CCCTTCACCTTCCCAGAATCCTG No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106296_1084106305 -8 Left 1084106296 11:66983008-66983030 CCCAGGGCCCCAGGCACTTAGAC No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106288_1084106305 16 Left 1084106288 11:66982984-66983006 CCTTCCCAGAATCCTGGCTTCGT No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106295_1084106305 -7 Left 1084106295 11:66983007-66983029 CCCCAGGGCCCCAGGCACTTAGA No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106289_1084106305 12 Left 1084106289 11:66982988-66983010 CCCAGAATCCTGGCTTCGTCCCC No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106293_1084106305 4 Left 1084106293 11:66982996-66983018 CCTGGCTTCGTCCCCAGGGCCCC No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106297_1084106305 -9 Left 1084106297 11:66983009-66983031 CCAGGGCCCCAGGCACTTAGACA No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106290_1084106305 11 Left 1084106290 11:66982989-66983011 CCAGAATCCTGGCTTCGTCCCCA No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data
1084106286_1084106305 22 Left 1084106286 11:66982978-66983000 CCTTCACCTTCCCAGAATCCTGG No data
Right 1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084106305 Original CRISPR ACTTAGACATCGGGTGTGGA GGG Intergenic
No off target data available for this crispr