ID: 1084110816

View in Genome Browser
Species Human (GRCh38)
Location 11:67013298-67013320
Sequence CACAAGAGCTTGCATGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084110816_1084110826 24 Left 1084110816 11:67013298-67013320 CCCTGGCCATGCAAGCTCTTGTG 0: 1
1: 0
2: 2
3: 20
4: 273
Right 1084110826 11:67013345-67013367 CTGCAGCTTCCTCAGGGTGCTGG 0: 1
1: 0
2: 3
3: 37
4: 339
1084110816_1084110822 18 Left 1084110816 11:67013298-67013320 CCCTGGCCATGCAAGCTCTTGTG 0: 1
1: 0
2: 2
3: 20
4: 273
Right 1084110822 11:67013339-67013361 GCCTCCCTGCAGCTTCCTCAGGG 0: 1
1: 0
2: 4
3: 38
4: 396
1084110816_1084110821 17 Left 1084110816 11:67013298-67013320 CCCTGGCCATGCAAGCTCTTGTG 0: 1
1: 0
2: 2
3: 20
4: 273
Right 1084110821 11:67013338-67013360 TGCCTCCCTGCAGCTTCCTCAGG 0: 1
1: 0
2: 6
3: 61
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084110816 Original CRISPR CACAAGAGCTTGCATGGCCA GGG (reversed) Intronic
900712818 1:4125213-4125235 CACATGAGCCAGCATGGACAGGG + Intergenic
902105226 1:14029944-14029966 AAAAAGAGCCTGCATTGCCAAGG - Intergenic
902584125 1:17427662-17427684 CACTTGAACTTGCTTGGCCAAGG + Intronic
904540208 1:31227768-31227790 CACAAGACCTTTCATGGCCCCGG + Intronic
906441423 1:45849254-45849276 AAAAAGAGCTTGAATAGCCAAGG + Intronic
907874569 1:58473161-58473183 CCCAAGAGCTTGCAAGGCCAAGG + Intronic
907949411 1:59167187-59167209 AAAAAGAGCTTGAATAGCCAGGG + Intergenic
909060796 1:70876924-70876946 AAAAAGAGCTTGAATGGCCAAGG - Intronic
909659426 1:78065570-78065592 CAAAAGAGCCTGAATAGCCAAGG + Intronic
909712949 1:78673194-78673216 CACAAGTGCCTGCATCGCCTTGG - Intergenic
910075149 1:83268138-83268160 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
912051461 1:105533987-105534009 AAAAAGAGCCTGAATGGCCAAGG - Intergenic
912379264 1:109238318-109238340 CACAAAAGCTTGCAGGGCAAGGG + Intergenic
913417813 1:118631234-118631256 AAAAAGAGCCTGCATAGCCAAGG - Intergenic
916055466 1:161066315-161066337 CTCAAGACCGTGCATGGGCATGG - Intronic
916085555 1:161266514-161266536 ACCATGAGCTGGCATGGCCAAGG + Intronic
917054405 1:170964007-170964029 TAAAAGAGCATGCATGGGCAGGG - Intronic
917377302 1:174363252-174363274 CAGAAAAGCTTGAATAGCCAAGG - Intronic
917822412 1:178777564-178777586 AAAAAGAGCCTGCATCGCCAAGG + Intronic
919986428 1:202679023-202679045 GGCAAATGCTTGCATGGCCAAGG - Intronic
1063883837 10:10557503-10557525 AAAAAGAGCTCGCATCGCCAAGG - Intergenic
1064156610 10:12907990-12908012 GACAAGATCTTAAATGGCCAGGG + Intronic
1064157219 10:12913065-12913087 CAAAAGACCTTGAATAGCCAAGG - Intronic
1064441040 10:15353942-15353964 CAGATGAGCGTGCATGCCCACGG - Intronic
1066156294 10:32681520-32681542 CCCAAGAGCCTGGTTGGCCAAGG + Intronic
1067765299 10:49081383-49081405 TACAAAAGCTTCCATGCCCATGG + Intronic
1068161987 10:53276574-53276596 AAAAAGAGCCTGCATAGCCAAGG + Intergenic
1068410992 10:56653998-56654020 TACAAGAGCTTCAGTGGCCATGG + Intergenic
1069193109 10:65514704-65514726 CACAAGATATTCCATGGTCATGG - Intergenic
1072564985 10:96609957-96609979 CACAGGAGCCTGCATGGGAAGGG + Intronic
1073362783 10:102913512-102913534 CACAAGATCTTGGCTGGCCATGG - Intergenic
1075254625 10:120915490-120915512 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1075255222 10:120920883-120920905 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1075739142 10:124682858-124682880 CTCAACAGCTCGGATGGCCAAGG + Intronic
1075818981 10:125289205-125289227 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
1076679540 10:132164549-132164571 CAGAGCAGCTGGCATGGCCATGG - Intronic
1076737050 10:132463591-132463613 CACAAGAGCTTTCCTGGTCTGGG + Intergenic
1078946561 11:16074891-16074913 AAAAAGAGCTTGAATAGCCAAGG + Intronic
1079353956 11:19714780-19714802 TAAAAGAGATTGCACGGCCAGGG - Intronic
1079599094 11:22289297-22289319 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1079667844 11:23130328-23130350 AAAAAGAGCTTGAATAGCCACGG - Intergenic
1080218496 11:29873219-29873241 AATAAGAGCTTGAATAGCCAAGG - Intergenic
1080488436 11:32735681-32735703 AAGAAGAGCTCGCATTGCCAAGG + Intronic
1080491275 11:32766992-32767014 AAGAAGAGCTCGCATTGCCAAGG + Intronic
1080697417 11:34614808-34614830 TACAAGATCTTACATGGACATGG - Intergenic
1081469283 11:43354846-43354868 GGGAAGAGCTGGCATGGCCAAGG - Intergenic
1082025568 11:47568939-47568961 CCCAACAGTTTGCAAGGCCAAGG - Intronic
1082574802 11:54789204-54789226 AAAAAGAGCTCGCATTGCCAAGG + Intergenic
1083064200 11:59906793-59906815 AAAAAGAGCCTGCATAGCCAAGG - Intergenic
1084110816 11:67013298-67013320 CACAAGAGCTTGCATGGCCAGGG - Intronic
1084162417 11:67356958-67356980 CTCCAGAGCCTGGATGGCCAAGG - Intronic
1086040908 11:82477645-82477667 AAAAAGAGCTTGTATAGCCAAGG + Intergenic
1087084936 11:94207941-94207963 CAAAAGACCCTGCATAGCCAAGG + Intergenic
1087087434 11:94233993-94234015 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1087088025 11:94239626-94239648 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1087561080 11:99791585-99791607 AAAAAGAGCTTGAATAGCCAAGG - Intronic
1087707101 11:101505762-101505784 CCCAGGACCTTGCAGGGCCAAGG + Intronic
1087844025 11:102950941-102950963 CACAGTAGCTAGCATAGCCATGG - Intronic
1089755408 11:120682541-120682563 GACAAGAGCATGCATGGATACGG - Intronic
1089950393 11:122520158-122520180 CACTTGAGCCTGCATGGTCAAGG + Intergenic
1090573769 11:128077562-128077584 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1091512745 12:1146040-1146062 AAAAAGAGCCTGCATAGCCAAGG - Intronic
1091849454 12:3683471-3683493 CTCAAGAGCTCCCAGGGCCATGG - Intronic
1092127315 12:6084009-6084031 CATGAGATCTTGCATGGCCCTGG + Intronic
1093778854 12:23110607-23110629 CAGTAGAGCTTGGATGGACAGGG + Intergenic
1096526150 12:52211535-52211557 CACAACTGCTTGCATGTCCCTGG - Intergenic
1096967113 12:55637305-55637327 CCCACGGGCCTGCATGGCCATGG + Exonic
1097583371 12:61485613-61485635 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
1097782191 12:63720947-63720969 CATAATAGATTGCAAGGCCAAGG - Intergenic
1098186761 12:67904736-67904758 AAAAAGAGCCTGCATGGCCAAGG + Intergenic
1098674474 12:73271459-73271481 AAAAAGAGCCTGAATGGCCAAGG + Intergenic
1099701456 12:86087904-86087926 AAAAAGAGCTTGAATAGCCAAGG + Intronic
1100025816 12:90126655-90126677 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
1100746546 12:97652600-97652622 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1102327550 12:112000982-112001004 CACGGGAGCTTGGATGGTCATGG - Intronic
1104333527 12:127870390-127870412 TAAAAGAGCCTGCATCGCCAAGG + Intergenic
1104718886 12:131033687-131033709 CACAGGGGCTTGCAGGGGCACGG + Intronic
1105597927 13:21857193-21857215 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1105872315 13:24516393-24516415 CATAAGTGCTAGCCTGGCCAAGG - Intergenic
1107154562 13:37151425-37151447 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1107712204 13:43161193-43161215 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1108414290 13:50181767-50181789 AAAAAGAGCCTGCATCGCCAAGG - Intronic
1109528049 13:63602238-63602260 AAAAAGAGCTTGAATAGCCAAGG - Intergenic
1109621510 13:64913327-64913349 CACAAAAGATTGAATAGCCAAGG + Intergenic
1109873970 13:68373751-68373773 CACAAGCACTTGCATGCCTATGG - Intergenic
1110842106 13:80154927-80154949 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1111300427 13:86342275-86342297 GACACCAGCTGGCATGGCCAAGG - Intergenic
1111499099 13:89092422-89092444 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1113563171 13:111300117-111300139 CACAAGAGCTTATATGGGAAAGG - Intronic
1114335342 14:21683651-21683673 CAACAGAGCTTGCATGCCCCTGG + Intergenic
1115038602 14:28891922-28891944 CACATGAGTTTGCATGTTCAAGG + Intergenic
1116471781 14:45294011-45294033 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
1116768582 14:49101242-49101264 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1117030317 14:51662325-51662347 AAAAAGAGCTTGAATAGCCAAGG + Intronic
1118325956 14:64780746-64780768 AAAAAGAGCCTGAATGGCCAAGG + Intronic
1118719879 14:68586430-68586452 CACATGAGCTTGCATTTCCATGG - Intronic
1121488011 14:94334217-94334239 CAAAAGATCTTGAATAGCCAAGG - Intergenic
1121928215 14:97948423-97948445 GCCAAGAGCTTACCTGGCCAAGG + Intronic
1122377215 14:101270735-101270757 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
1123402966 15:20004642-20004664 CCCATGGGCTTTCATGGCCAAGG + Intergenic
1123512306 15:21011296-21011318 CCCATGGGCTTTCATGGCCAAGG + Intergenic
1125709018 15:41768680-41768702 CACAAGAGCTTCCAGTGCCTGGG + Exonic
1126261088 15:46692417-46692439 CAGAAGGTCTTGCATGTCCATGG - Intergenic
1126927281 15:53604002-53604024 AAAAAGAGCCTGAATGGCCAGGG + Intronic
1127163787 15:56221151-56221173 AAAAAGAGCCTGAATGGCCAAGG - Intronic
1127180846 15:56415708-56415730 CAAAAGAGCCTGAATAGCCAAGG - Intronic
1127405455 15:58640154-58640176 GACAATAGCTTTCATGGCTAAGG + Intronic
1127932196 15:63604327-63604349 CAAAAGAGCTTCCATGGGAAAGG - Intergenic
1128149589 15:65355011-65355033 CCCAAGAACTTGCCAGGCCAGGG - Intronic
1131584633 15:93679938-93679960 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
1132585013 16:702297-702319 GAGAAGAGCTTGCAGGGCTAAGG - Intronic
1133061267 16:3175852-3175874 CACCAAATCTTGCATCGCCAGGG - Intergenic
1138303974 16:55957448-55957470 CCCAAGACCCTGCATGGCCTTGG + Intergenic
1139656103 16:68388067-68388089 TACAAGATCCTGGATGGCCACGG + Intronic
1140492867 16:75354583-75354605 CCCAACATCTTGCATAGCCATGG - Intronic
1141441565 16:84032849-84032871 CACATGTGCGTGCATGGGCACGG + Intronic
1143130733 17:4675346-4675368 CTCCAGAGCTTGCATGGAGATGG - Exonic
1145018817 17:19414865-19414887 CACCAGGGCTTGCATGGCCTTGG - Exonic
1145246401 17:21272697-21272719 CACATGAGCTTGAATGGAGAAGG - Intergenic
1146204383 17:30889644-30889666 CACAAGACCTGGCATGGAGAAGG - Intronic
1147054584 17:37824576-37824598 CACAAGAGCCAGCATGGCCAGGG + Intergenic
1147529195 17:41258329-41258351 AAAAAGAGCCTGAATGGCCAAGG - Intergenic
1148352997 17:46954495-46954517 AAAAAGAGCCTGCATTGCCAAGG - Intronic
1150128179 17:62652393-62652415 CACAAGTGATCGCGTGGCCACGG + Intronic
1151393360 17:73802712-73802734 CACAGGAGCTGGTATTGCCATGG - Intergenic
1151428942 17:74049707-74049729 GACAGGAGCTTGCAGGGACAAGG - Intergenic
1156393485 18:36675213-36675235 GCTAAGAACTTGCATGGCCAGGG - Intronic
1157914483 18:51651512-51651534 TAGAAGGGTTTGCATGGCCATGG + Intergenic
1159648002 18:70942802-70942824 GACATCAGCTTGCATTGCCAAGG + Intergenic
1160250066 18:77195259-77195281 TAAAAGAGCTTGAATGGCCAAGG - Intergenic
1161308084 19:3578266-3578288 CACCAGTGCTAGGATGGCCATGG + Intronic
1164847644 19:31448288-31448310 GAGAAGAGCTAACATGGCCAGGG - Intergenic
1164886053 19:31779618-31779640 CACAAGATCCTTCATGGCCTGGG + Intergenic
926362046 2:12098407-12098429 CAGAAGAGAATGCACGGCCAAGG + Intergenic
927426658 2:22988697-22988719 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
927981504 2:27377681-27377703 CACCAGAAGGTGCATGGCCACGG - Exonic
928260166 2:29759403-29759425 CACATGCACTTGCATGCCCAGGG - Intronic
929450779 2:42035661-42035683 CACAAGAGTTTCCCTGTCCAGGG + Intergenic
930416617 2:51097434-51097456 CACCAGCACTTGCATGTCCAAGG + Intergenic
932925819 2:75973094-75973116 AAAAAGAGCTTGCATTACCAAGG + Intergenic
933816556 2:86073374-86073396 CAGCAGAGCCTGCATGGCCCAGG + Intronic
936438905 2:112533255-112533277 CAGCAGAGATTGCATGGGCAGGG + Exonic
938213956 2:129492298-129492320 CACAGGAGCGTGCATGGCACTGG + Intergenic
939988695 2:148857025-148857047 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
940136496 2:150442129-150442151 AACATAAGCTTTCATGGCCAAGG + Intergenic
942830470 2:180233195-180233217 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
943493069 2:188581077-188581099 CACAAGAGCATGGCTGGCCAGGG - Intronic
943788914 2:191909762-191909784 CACAGCACCTTGCGTGGCCAAGG - Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944339984 2:198584770-198584792 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
948231160 2:236350664-236350686 CACAAGCCCTTGCATGGACCAGG + Intronic
948333606 2:237191058-237191080 CACAAGAGTCTCCCTGGCCAGGG - Intergenic
948367927 2:237470521-237470543 CATGAGAGCCTGCATTGCCAGGG - Intergenic
1170166559 20:13365705-13365727 TACAAGATCTTCCATGGCCCGGG - Intergenic
1171154920 20:22863030-22863052 CTCAAGAGCTGCCGTGGCCAGGG + Intergenic
1173932615 20:46833180-46833202 CAGATGAGTTTGCTTGGCCATGG - Intergenic
1174125249 20:48299620-48299642 CATAAGATCTTGCTTGGCCAAGG + Intergenic
1175626329 20:60490998-60491020 CACAGGACCTTGCAGGGCCTTGG + Intergenic
1175905656 20:62378160-62378182 CACAAGAACTTCCAGGGCCTCGG + Intergenic
1177315079 21:19449388-19449410 CAAAAGAGCCTGAATAGCCAAGG + Intergenic
1180557849 22:16592083-16592105 CCCCAGAGATTGGATGGCCAGGG + Exonic
1181434670 22:22903709-22903731 CAAAATAGCTTGCAAGGACAGGG + Intergenic
1183065527 22:35360087-35360109 CACAAGACCTGACATGGCCCTGG - Intergenic
1183866165 22:40705929-40705951 CACAAGAGCTTCCATCCCCTTGG + Intergenic
1184423682 22:44396470-44396492 CACAGGAGCTACCATTGCCACGG - Intergenic
1184601321 22:45545171-45545193 CACAAGAACGTGTATGGACAAGG + Intronic
950619259 3:14190264-14190286 AAAAAGAGCCTGCATAGCCAAGG - Intronic
950622525 3:14217186-14217208 CAAAAGTGCTTGTATGGCCTAGG + Intergenic
950709934 3:14806852-14806874 CACATGAGCTTGCAGAGCCTGGG + Intergenic
952016356 3:28961390-28961412 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
952074126 3:29674925-29674947 AAAAAGAGCCTGCATTGCCAAGG + Intronic
952514342 3:34089307-34089329 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
953574274 3:44100456-44100478 CTCAAGAACCTGCATGGCTAGGG + Intergenic
954934438 3:54313616-54313638 CACTGGAGCATGGATGGCCACGG - Intronic
957721246 3:84002514-84002536 AAAAAGAGCCTGCATAGCCAAGG - Intergenic
957874710 3:86130446-86130468 AAAAAGAGCCTGCATTGCCAAGG - Intergenic
958489180 3:94750004-94750026 AAAAAGAGCCCGCATGGCCAAGG + Intergenic
959338091 3:105092293-105092315 CAAAAGAGCCTGAATAGCCAAGG - Intergenic
961649856 3:128411855-128411877 CACATGCACATGCATGGCCAGGG - Intergenic
962412535 3:135153901-135153923 CACAGGAGCTGGAATGGACATGG - Intronic
964627739 3:158775671-158775693 CCCCAGGGCTTGGATGGCCAAGG + Intronic
965001880 3:162964506-162964528 CACAATAGCTTGCCAGGCTATGG + Intergenic
965947498 3:174261154-174261176 AAAAAGAGCCTGCATCGCCAAGG - Intronic
967228190 3:187312978-187313000 GACAAGAGATGGCATGGCCTGGG - Intergenic
967277052 3:187786470-187786492 CAAAAGAGCTTCCATTCCCATGG - Intergenic
968013299 3:195302045-195302067 CACAACAGCTGGCATTGCCAGGG + Exonic
968631042 4:1651693-1651715 GACCAGCGCTTGCATGGACAGGG + Intronic
970532136 4:16995680-16995702 AACAAGAGCTTGCATTTCAATGG + Intergenic
970975279 4:22036315-22036337 GAAAAGAGCCTGCATTGCCAAGG - Intergenic
971866262 4:32176631-32176653 CAAAAGAGCTTGCAGAACCAGGG + Intergenic
974370985 4:61016301-61016323 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
974514843 4:62896675-62896697 CACAGGGGCTTGGAAGGCCAGGG - Intergenic
974955965 4:68641700-68641722 AAAAAGAGCTTGTATAGCCAAGG - Intronic
975367068 4:73541743-73541765 CAACAGAGAATGCATGGCCAAGG - Intergenic
975894585 4:79073558-79073580 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
976105172 4:81609285-81609307 AACAAGAGCCTGCATAGCCAAGG + Intronic
976366554 4:84239438-84239460 CACAGGACATTGCAAGGCCATGG - Intergenic
978680031 4:111369060-111369082 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
979604238 4:122620338-122620360 CTCAAAAGCTTTCATGCCCAAGG + Intronic
979800086 4:124897545-124897567 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
979860373 4:125686131-125686153 CAAAAGAGCATGCATGGGTAGGG + Intergenic
980216472 4:129858421-129858443 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
981975501 4:150723210-150723232 CACACCAGCTTGCGTGGCTAAGG + Intronic
982511256 4:156286056-156286078 AAAAAGAGCCTGCATCGCCATGG - Intergenic
982725143 4:158898307-158898329 AAAAAGAGCCTGCATAGCCAAGG - Intronic
984370610 4:178860010-178860032 AAAAAGAGCCTGCATTGCCAAGG - Intergenic
987644631 5:20652736-20652758 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
987915786 5:24211990-24212012 AAAAAGAGCTTGAATAGCCAAGG - Intergenic
991102486 5:62808271-62808293 AAAAAGAGCTCGCATAGCCAAGG - Intergenic
993676113 5:90817883-90817905 AAAAAGAGCCTGCATCGCCAAGG - Intronic
996006343 5:118425193-118425215 CAAAAGAGCCTGTATAGCCAAGG + Intergenic
998776170 5:145605642-145605664 TAAAAGAGCTTGAATAGCCAAGG - Intronic
999916703 5:156270336-156270358 AAAAAGAGCTTGAATAGCCAAGG - Intronic
1001220665 5:169897717-169897739 GACAAATGCTTGCATGGACAGGG - Intronic
1001652850 5:173327922-173327944 CCCAAGAGTTTGCGTGGCCCTGG + Intronic
1002765651 6:236453-236475 GACATGAGCTTCCAGGGCCATGG - Intergenic
1005980767 6:30834879-30834901 GACCAGAGCTTTCATGCCCAGGG + Intergenic
1006106800 6:31721665-31721687 CATAAGGGCTTTCATGGCGAGGG + Exonic
1006592476 6:35168719-35168741 TAAAACAGCTTGCATGGCCAGGG + Intergenic
1007583255 6:42972172-42972194 CATAAGAGCCTTCATGTCCAAGG - Intronic
1008275571 6:49540169-49540191 CACTTGAGCCTGCAAGGCCAAGG + Intergenic
1008900482 6:56609006-56609028 CTCAAGAACTTTGATGGCCATGG + Intronic
1009289065 6:61861682-61861704 CAAAAGAGCCTGAATAGCCAAGG - Intronic
1009362342 6:62829909-62829931 TAAAAGAGCCTGCATAGCCAAGG + Intergenic
1010538418 6:77060975-77060997 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1013387814 6:109649756-109649778 AAAAAGAGCTGGCATCGCCAAGG + Intronic
1013389476 6:109668867-109668889 AAAAAGAGCTGGCATCGCCAAGG - Intronic
1013767004 6:113586531-113586553 CACAAGAGCTTTCATCACAATGG - Intergenic
1013935885 6:115593273-115593295 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1014860136 6:126456225-126456247 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
1014907527 6:127047906-127047928 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
1015029764 6:128580601-128580623 GAGAAGAGCTCGCCTGGCCATGG - Intergenic
1017756284 6:157532048-157532070 CCCCAGTGCTTCCATGGCCAGGG - Intronic
1018222799 6:161597712-161597734 CACATGTGCCTGCATGGGCAGGG - Intronic
1019053982 6:169207102-169207124 CCCAAGAGTTTGCAAGGCCGAGG + Intergenic
1019358647 7:593938-593960 CACAAGAGCCGGCATCGCCGTGG + Intronic
1020108117 7:5432008-5432030 CACACCAGCTTCTATGGCCATGG + Intronic
1022438891 7:30415947-30415969 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1023505305 7:40893690-40893712 CAAAAGAGCCTGAATAGCCAAGG + Intergenic
1023665083 7:42514488-42514510 GCCAAGAGCTGGCTTGGCCATGG - Intergenic
1023987183 7:45103522-45103544 GAGGAGAGCCTGCATGGCCAGGG + Intronic
1027608819 7:80333798-80333820 CATAAAAGCTTGCAAGTCCAAGG + Intergenic
1027882922 7:83865430-83865452 CACCAGAGCTTGCATGGGTGTGG + Intergenic
1027988795 7:85331187-85331209 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1028071663 7:86458504-86458526 AAAAAGAGCCTGCATTGCCAAGG - Intergenic
1028784689 7:94778682-94778704 CAAAAGAGCTAACATAGCCAAGG + Intergenic
1029291591 7:99505550-99505572 TACAAGAGCTTGACAGGCCAAGG - Intronic
1031607530 7:123787489-123787511 CTCCAAAGCTTGCAAGGCCATGG + Intergenic
1032361562 7:131260625-131260647 AAAAAGAGCTTGAATAGCCAGGG + Intronic
1032941420 7:136797151-136797173 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1033891176 7:146015031-146015053 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1034283570 7:149869969-149869991 CACATGAGCTGACATAGCCACGG + Intergenic
1034619466 7:152445922-152445944 CCCCAGAGATTGGATGGCCAGGG - Intergenic
1038492391 8:27980496-27980518 CACAGGAGATGGCATGGCCTAGG + Intronic
1040555839 8:48476896-48476918 CAGAGGAGGCTGCATGGCCAGGG - Intergenic
1040876623 8:52159020-52159042 TATAAGAGCTGGCACGGCCAGGG + Exonic
1043807785 8:84694626-84694648 CAGAAGACCTTGAATAGCCAAGG + Intronic
1045760359 8:105599006-105599028 CACACTAGCTAGCATGGCTATGG + Intronic
1046134869 8:110012443-110012465 AAAAAGAGCCTGCATAGCCAAGG - Intergenic
1046887276 8:119381333-119381355 CAAAAGAGCCTGCATAGCCAAGG + Intergenic
1049525797 8:143126314-143126336 CACAAGAGCTTGCAGCGTCTTGG - Intergenic
1051460403 9:17306919-17306941 CACAAGAGCTAACCTGGCTAGGG - Intronic
1052072183 9:24094883-24094905 AAAAAGAGCTCGCATCGCCAAGG - Intergenic
1052282640 9:26750673-26750695 CACAGGGGCCTGCATTGCCACGG - Intergenic
1052767354 9:32655050-32655072 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
1052865142 9:33460302-33460324 CACATGAGGTGGCAGGGCCAGGG + Intergenic
1054940900 9:70740501-70740523 AAAAAGAGCTTGCATAGCCAAGG + Intronic
1055246928 9:74258087-74258109 AAAAAGAGCCCGCATGGCCAAGG - Intergenic
1055260611 9:74428811-74428833 AAAAAGAGCCCGCATGGCCAAGG + Intergenic
1055492264 9:76817548-76817570 GAGAAGAGCTTGGAGGGCCAAGG - Intronic
1055523249 9:77103883-77103905 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
1055617434 9:78087623-78087645 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
1055695303 9:78877167-78877189 AAAAAGAGCCTGCATCGCCAAGG + Intergenic
1055853101 9:80655585-80655607 AAAAAGAGCTTGCATCGCCAAGG - Intergenic
1057511691 9:95685249-95685271 CACGTAAGATTGCATGGCCAGGG + Intergenic
1058921650 9:109621638-109621660 AAAAAGAGCTTGAATAGCCAAGG + Intergenic
1059422587 9:114201462-114201484 CAGAAGAGCGAGCATAGCCAAGG - Intronic
1062214630 9:135382577-135382599 CACAAGAGGCAGCCTGGCCATGG + Intergenic
1186861659 X:13678736-13678758 AAAAAGAGCCTGCATTGCCAAGG + Intronic
1188421184 X:29992192-29992214 CACAAGCGCTTTCTTGGCCAGGG + Intergenic
1188796807 X:34477004-34477026 CAAAAGAGCTTGAATACCCAGGG - Intergenic
1189442621 X:41050842-41050864 CACAACACTTTGCAAGGCCAAGG + Intergenic
1190590852 X:51999107-51999129 CAAAAGAGCCTGAATAGCCAAGG - Intergenic
1192717193 X:73656771-73656793 AAAAAGAGCTTGAATGGCCAAGG - Intronic
1192974818 X:76271940-76271962 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
1193074251 X:77338622-77338644 AAAAAGAGCCTGCATTGCCAAGG + Intergenic
1193182408 X:78473322-78473344 AAAAAGAGCCTGCATAGCCAAGG - Intergenic
1193230517 X:79039732-79039754 AAAAAGAGCCTGAATGGCCAAGG - Intergenic
1193435546 X:81470950-81470972 TAAAAGAGCCTGCATTGCCAAGG - Intergenic
1198378206 X:136060321-136060343 GGCAAAAGCTTGCATGGCCATGG - Intergenic
1198794390 X:140380111-140380133 AAAAAGAGCCTGCATAGCCAAGG + Intergenic
1199669655 X:150132879-150132901 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1199674081 X:150170371-150170393 AAAAAGAGCCTGCATCGCCAAGG - Intergenic
1200784810 Y:7251027-7251049 AAAAAGAGCCTGCATGGCCAAGG - Intergenic
1200904902 Y:8472017-8472039 CACAATAATTTGCATGGGCATGG - Intergenic
1201625365 Y:16008851-16008873 AAAAAGAGCCTGCATTGCCAAGG - Intergenic