ID: 1084111158

View in Genome Browser
Species Human (GRCh38)
Location 11:67014979-67015001
Sequence TCTTTTAAGTAGTTTGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 2, 2: 5, 3: 27, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084111158 Original CRISPR TCTTTTAAGTAGTTTGTGGC GGG (reversed) Intronic
900292796 1:1930880-1930902 TCTTTTTAATAGATGGTGGCAGG - Intronic
900833571 1:4982848-4982870 TTTTCTAAGTAGTTTGTGCAAGG - Intergenic
902177681 1:14663278-14663300 TCTTTTAAGTAGTACATGGGAGG + Intronic
902316488 1:15623762-15623784 TCTTATAAATAGTTAGTGGCCGG + Intronic
904063796 1:27732116-27732138 TCTTTTAATTATTATGTGGCTGG - Intronic
904328577 1:29743681-29743703 TCATTTTAATTGTTTGTGGCAGG + Intergenic
906160645 1:43646726-43646748 TCTATTAAGAATTTTTTGGCCGG + Intergenic
906682875 1:47742635-47742657 TCTTTTGAGGAGTTTGTGTGAGG + Intergenic
908378291 1:63569197-63569219 TATTTTAAGAAATTTATGGCAGG - Intronic
908948808 1:69534557-69534579 TCTTTTAGTTAGTATTTGGCTGG - Intergenic
908997503 1:70174531-70174553 TCTTTTCAGTAGTTAGTTGATGG - Intronic
909095786 1:71287012-71287034 GCTTTTAAGTAGTTTAATGCTGG - Intergenic
910489065 1:87747968-87747990 ACTTGTAAGTACCTTGTGGCAGG + Intergenic
910953896 1:92680615-92680637 TGTAATAAGTAATTTGTGGCAGG - Intronic
913202989 1:116511131-116511153 TCTTATAGCTAGTTCGTGGCAGG - Intergenic
914673507 1:149889719-149889741 TGATTTAAGTATTTTCTGGCCGG - Intronic
915781913 1:158561855-158561877 TGTTTTAAGTAATTAGTGCCAGG - Intergenic
915837762 1:159191522-159191544 TCTTATATGTAGGTGGTGGCAGG + Intronic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
918455534 1:184708797-184708819 TCCTTTAAGAAATTTGTGTCTGG + Intronic
919126573 1:193401512-193401534 TCTTTTATGTAGTTGTTGGCAGG - Intergenic
919637432 1:200016517-200016539 TCTTTAAAGTAGTTTGCTCCTGG + Intergenic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
922340829 1:224653781-224653803 TCCTTTAAAGAGTTTGAGGCTGG + Intronic
922496916 1:226063980-226064002 TCTTTTGACTTGTTTGTGGATGG + Exonic
923155579 1:231276166-231276188 TCTTCTAATTTGGTTGTGGCAGG - Exonic
923177074 1:231477044-231477066 TCTCACAATTAGTTTGTGGCAGG - Intergenic
923714924 1:236416855-236416877 TCATTAAAGTTGTTTATGGCCGG + Intronic
1063654058 10:7969554-7969576 TCTTTTAAGTGATTTTTGGAGGG + Intronic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065297875 10:24293895-24293917 TCTTTGAAATAGTTCCTGGCCGG + Intronic
1065491296 10:26284421-26284443 TGTTTTAAATAGTTTGGGACAGG + Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067808464 10:49409282-49409304 TTTTTTAAGTTGTTTGTGCCGGG + Intergenic
1069266810 10:66469087-66469109 TTTATTAAATAGTTTGTGCCAGG + Intronic
1069482861 10:68799523-68799545 ACTTTTAAAGAGTTCGTGGCTGG + Intergenic
1074110889 10:110422162-110422184 TCTTTTAAGAAGTGAGTGCCAGG + Intergenic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1078944652 11:16050771-16050793 TATTTCAAGTATTTTATGGCAGG - Intronic
1079036803 11:17026979-17027001 TCTGGTAGGTAGCTTGTGGCAGG + Intergenic
1079825741 11:25190004-25190026 TCTTTTAAATAGTCTCAGGCCGG - Intergenic
1081202556 11:40235155-40235177 TCATTTAACTATCTTGTGGCAGG + Intronic
1081478579 11:43461484-43461506 TCTTTTAAGAACATTTTGGCTGG - Intronic
1083206598 11:61153555-61153577 GCTTTTTAGTTTTTTGTGGCAGG - Intronic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084381664 11:68816675-68816697 TCCATTTAGTACTTTGTGGCAGG - Intronic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086547510 11:88015134-88015156 TTTCTTAAGAAGTATGTGGCTGG + Intergenic
1087246814 11:95848745-95848767 TTCTTTCAGTAGTTTGTTGCTGG - Intronic
1087544928 11:99573272-99573294 TGTTTTAAATAGTTCCTGGCCGG + Intronic
1089714112 11:120339705-120339727 TCTGTTTTGCAGTTTGTGGCAGG + Intronic
1091576185 12:1738074-1738096 TAGTTTTAGTAGTTTATGGCTGG + Intronic
1091745665 12:2991359-2991381 TCTTTTAAGTAGTTTGTTTCAGG + Intronic
1091962926 12:4714066-4714088 TCATTAAAATAATTTGTGGCCGG + Intronic
1092476374 12:8822427-8822449 TCTTTAAAGTTGTTTCTGCCTGG - Intergenic
1092630163 12:10368269-10368291 TCTTTTAAGTATTTTGTCTGTGG - Intergenic
1094684821 12:32700978-32701000 TCATTTAAAAAGTCTGTGGCCGG + Intronic
1100525355 12:95413992-95414014 TCTTTTAAGAAATTTCTGGCTGG - Intergenic
1100960808 12:99960929-99960951 TCTTTAAAGAAGTTAGGGGCTGG + Intronic
1102342341 12:112132960-112132982 TCTTTAATGTAGTTTTTAGCTGG + Intronic
1103693289 12:122793347-122793369 TCTTTTCAGTGGTTTGTGTTAGG - Intronic
1106059279 13:26271160-26271182 TCTTTTTAGTAGTTAGTTGTAGG + Intronic
1106264262 13:28096056-28096078 ATTTTTAAGTAGTTTTAGGCTGG + Intronic
1106622574 13:31385261-31385283 TTTAAAAAGTAGTTTGTGGCCGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107645427 13:42489891-42489913 ACTTTTAAATAGTTTGTGTGGGG - Intergenic
1108897963 13:55359086-55359108 TGTTTTAAGCATTTTCTGGCAGG + Intergenic
1109705786 13:66090807-66090829 TTTTTTAAGTTGTTTCTGGATGG - Intergenic
1110171633 13:72507686-72507708 TATTTTAAGTTGTATGTGGAGGG - Intergenic
1110234161 13:73198789-73198811 TCTTCTGAGTAGTTTGGGCCAGG + Intergenic
1111097750 13:83536710-83536732 TCTTTTCAGTACTTTCTGCCTGG - Intergenic
1112608367 13:100930220-100930242 TCTTTTAAGTTGCTTGTAGGGGG + Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114248997 14:20941343-20941365 CCTTTTAGGTTTTTTGTGGCTGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115272056 14:31563627-31563649 ATTTTGAAGTAGTTTGAGGCAGG - Intronic
1115887412 14:37988448-37988470 CCTTTTAAGAATTTTGAGGCTGG + Intronic
1115984465 14:39089642-39089664 TCTTTTAAGAGGTTTGTTGAAGG - Intronic
1116486070 14:45450713-45450735 TCTTTTAAGTAGTATATACCTGG + Intergenic
1117052964 14:51880521-51880543 TCTTTTGAGTAGAATATGGCTGG + Intronic
1117205509 14:53438757-53438779 TTTTTTAAATAGTGGGTGGCAGG - Intergenic
1118292211 14:64537602-64537624 TCTTTTGTGTAGTTTGGGGGTGG - Intronic
1118370589 14:65134409-65134431 TCTTTTAAGAAGATGTTGGCCGG + Intergenic
1123771792 15:23536639-23536661 TCTTTCAAATAGTGTGTGCCAGG + Intergenic
1123948898 15:25252037-25252059 TCTTTCCAGGATTTTGTGGCAGG + Intergenic
1125807960 15:42510430-42510452 TCTTTTCAGTCATTTTTGGCTGG - Intronic
1127590696 15:60419482-60419504 TCTTTTCAGTAATTTTTGCCTGG + Intergenic
1128433338 15:67621113-67621135 TCTTTTGATTAGTTTTTGCCAGG - Intronic
1128558822 15:68651128-68651150 TCAAGTAAGTAGTTTGAGGCAGG + Intronic
1128844425 15:70877831-70877853 TATTTTAAATTCTTTGTGGCTGG + Intronic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131536145 15:93239686-93239708 TCTTGGAAGTAGTTTCTGACAGG + Intergenic
1133382697 16:5344626-5344648 TCCTGACAGTAGTTTGTGGCAGG + Intergenic
1133776607 16:8900936-8900958 TATTCTTAGTAGTTTGTGGAGGG - Intronic
1134443661 16:14314561-14314583 TCATTTAAGTAGGTTGGGTCCGG - Intergenic
1135092251 16:19527110-19527132 TGTTTTAAGTAGTTTGGTGATGG + Intronic
1137296566 16:47099154-47099176 TCTTTTAAGAATGTTGAGGCTGG - Intronic
1139217529 16:65142703-65142725 TCTTTTTATTAGTTATTGGCAGG - Intergenic
1141836231 16:86541625-86541647 TCTTTTAAGTGTTTTCTGTCTGG - Intronic
1142676697 17:1517674-1517696 TATTTAAAGTAGTTTTAGGCCGG - Intergenic
1144655878 17:17036244-17036266 TTATTTAAGTAGTAAGTGGCGGG - Intergenic
1145008627 17:19353268-19353290 TCTCTTAAGAAATTAGTGGCTGG - Intronic
1147188875 17:38727485-38727507 TCTTTTCAGTGGTTTGGGGCAGG - Exonic
1147940229 17:44041635-44041657 TCTTTTGATCAGTTTGTGGATGG - Intronic
1149971590 17:61223618-61223640 TCTTTTAGCTAGTTATTGGCAGG - Intronic
1150886599 17:69093568-69093590 ACTTTTAAGCATTTTGGGGCGGG - Intronic
1153605888 18:6831414-6831436 TCTTTTCTGTTGTTTGTTGCTGG + Intronic
1153664650 18:7358095-7358117 TCATTTCATAAGTTTGTGGCAGG - Intergenic
1153961255 18:10141941-10141963 TCTTTTAGACAATTTGTGGCGGG - Intergenic
1155754825 18:29478667-29478689 TCTTTTAAGAAGTGTGAGCCGGG - Intergenic
1156772587 18:40747656-40747678 ACTTTTTAGAAGTTTGTGGGTGG + Intergenic
1157004343 18:43563975-43563997 TGTTTTCAGTATTTGGTGGCTGG - Intergenic
1157448880 18:47770506-47770528 TCTTGTAGGTAGCTTGTAGCTGG - Intergenic
1159497822 18:69228739-69228761 TCTTGTAATTAGTTTGTGCAAGG - Intergenic
1159508610 18:69366649-69366671 TTTATTAAGTAGATTGTGGTTGG + Intergenic
1159610483 18:70519776-70519798 TCTTTTAAGTTTTTGGTGGCTGG + Intergenic
1159705631 18:71683106-71683128 TTTTTTATGTACTTTGTGCCAGG - Intergenic
1162406585 19:10478478-10478500 TTTTTTAAGTAGCTGGGGGCAGG - Intergenic
1164545214 19:29154971-29154993 TCTTTTAAGTGGTTTGTGAGAGG - Intergenic
1166319936 19:42011254-42011276 ACTTGAAAGTATTTTGTGGCTGG + Intronic
1168441263 19:56369155-56369177 TCTTTTAAGCACTGTGTGGTGGG + Intergenic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
926909554 2:17838745-17838767 TCTTTTAAATATTTTATGACAGG + Intergenic
926999425 2:18777408-18777430 GCTTTTAAGTGGTTTGAGGCTGG - Intergenic
928112215 2:28519769-28519791 TATTTGAAGTAGCTTGGGGCAGG + Intronic
932816539 2:74866386-74866408 TCCTTTGAGAAGGTTGTGGCAGG + Intronic
933017354 2:77145470-77145492 TCTTAAAAGTTGTATGTGGCTGG + Intronic
935808842 2:106775470-106775492 CCTTCTAAATAGTGTGTGGCTGG + Intergenic
936347254 2:111684505-111684527 TCCTTAAAGTAATTTGTGCCTGG - Intergenic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
936483093 2:112903917-112903939 TCTTTTAATTAGTTTTTGTGTGG - Intergenic
937616495 2:123929032-123929054 TCTTTTTAGTTTTTTGTGGAGGG + Intergenic
937734506 2:125273324-125273346 TTTTTTAATTAGTTTTTGTCTGG - Intergenic
937810499 2:126194605-126194627 TGTTTTTAGTAATTTGAGGCAGG + Intergenic
939305753 2:140408503-140408525 TTTTTTAAGTAATTTGTTGGAGG + Intronic
939453596 2:142403376-142403398 TCTTATAAGTAGCTTATGGTGGG - Intergenic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
942771586 2:179527111-179527133 GCTTTTAAGTATTTTGAGGCTGG + Intronic
944214103 2:197236697-197236719 TTTTTTGAGTAGTTTGTTGCAGG - Intronic
945436763 2:209827730-209827752 TATTTTAAGTAGTTTCTGAAAGG - Intronic
946592764 2:221269655-221269677 TCGTGTTAGTATTTTGTGGCTGG + Intergenic
946901655 2:224379053-224379075 TCTTTAAAGTTGTTTGTATCTGG - Exonic
948954689 2:241278849-241278871 TATTTTTAATAGTTTGTTGCTGG - Intronic
1169064599 20:2687724-2687746 TCTTTGAAGTGGTTTGTGATTGG + Intergenic
1169456759 20:5758858-5758880 TCTTTTGAGAAGTCTGTGGAGGG + Intronic
1170495716 20:16923020-16923042 CCTCTCAAGTAGTTTGAGGCTGG + Intergenic
1170640948 20:18152154-18152176 TCTTTTAAGCTGTGTGTGGTGGG + Intronic
1170905493 20:20512436-20512458 TCTTTTTATCAGTTTGTGGTTGG - Intronic
1171100514 20:22379485-22379507 TGTTTCAAGGAGATTGTGGCTGG - Intergenic
1171849372 20:30297155-30297177 TATTTTAAAAAGCTTGTGGCCGG - Intergenic
1172400203 20:34644145-34644167 TGTGGTAAGTAGTTTGTGGGTGG - Exonic
1174887679 20:54353507-54353529 TAATTTAAGAACTTTGTGGCTGG + Intergenic
1175198811 20:57264714-57264736 TATTTTAAGTATTTAGTGGTAGG - Intronic
1177414025 21:20771421-20771443 TCTTTTCAATATTTTGTGGTAGG + Intergenic
1178677680 21:34645021-34645043 TCTGTGAAGTGGTTTTTGGCAGG - Intergenic
1178775784 21:35549048-35549070 CCCATTAAGTAGTTTGTGGGTGG + Intronic
1180102218 21:45593870-45593892 TGTTTTCTGTAGTTTGAGGCTGG + Intergenic
1180939448 22:19647766-19647788 TTTTTTAAATAATTTATGGCTGG - Intergenic
1182389275 22:29977848-29977870 TCTTAAAAGTAGTGTGGGGCTGG + Intronic
1183550509 22:38480493-38480515 TCATTTAAGTTATTTTTGGCCGG + Intronic
1183926706 22:41211499-41211521 TCTTCTAACGAGTTTGGGGCTGG - Intronic
949151260 3:770472-770494 TCTTTTTAGTGGTGTTTGGCTGG - Intergenic
949587583 3:5456967-5456989 GCTTTTAAGAAAATTGTGGCTGG - Intergenic
949973846 3:9435982-9436004 TCTTTTAAGAAGTTTGATCCAGG + Intronic
950414191 3:12859091-12859113 TCATATAAGTTGTTTCTGGCTGG - Intronic
950849236 3:16046739-16046761 TCTTTTAAGTACTTTGTCATAGG - Intergenic
952602600 3:35103654-35103676 TGTTTTAATTAGTTTGTAGTAGG - Intergenic
955685021 3:61540847-61540869 TATTTTCACTAGTTTGTGGGTGG - Intergenic
955809677 3:62774219-62774241 CCTTTTAAGAGCTTTGTGGCCGG - Intronic
956345781 3:68276783-68276805 TTTTTAAAATAGTTTGTGGAGGG + Intronic
956817456 3:72921355-72921377 TCTTTTGTGTTATTTGTGGCAGG - Intronic
957469518 3:80640209-80640231 CATTTTAACTATTTTGTGGCTGG - Intergenic
959034191 3:101340745-101340767 TCTCTTAAGTTTTATGTGGCAGG - Intronic
959969703 3:112395574-112395596 TCTGTTAAGTCGTTAGTGGAAGG + Intergenic
963792602 3:149599590-149599612 CCATTTAAGTAGTTTGAGACTGG - Intronic
964199585 3:154103536-154103558 TCTTTCAGGTGGTTTCTGGCAGG + Intergenic
964689380 3:159432881-159432903 TCTTTGATGTAGTATGTTGCAGG + Intronic
965833713 3:172828077-172828099 TATTTTTACTTGTTTGTGGCTGG - Intergenic
966903354 3:184503434-184503456 TAATTTAAGTATTTTTTGGCAGG - Intronic
967325592 3:188235428-188235450 TATTTTAGGTATTTTGTGGTGGG + Intronic
967946728 3:194809976-194809998 TCTTTTATGGAGTTTATGGGAGG + Intergenic
969967228 4:11009729-11009751 TCTTATTAGTACTTTGTTGCAGG + Intergenic
970093994 4:12441993-12442015 ACTTTTAAGTACTTTGCTGCTGG + Intergenic
971359692 4:25925542-25925564 GCTTTTAAGTATTTATTGGCAGG + Intronic
971643343 4:29163691-29163713 TTTTCTAAGCACTTTGTGGCAGG + Intergenic
972577153 4:40362502-40362524 TATTAAAAGTAATTTGTGGCTGG - Intergenic
973620406 4:52720634-52720656 TGTTAAAAGTAGTTTCTGGCTGG - Intergenic
975602595 4:76118549-76118571 TTTTTTAATTTTTTTGTGGCGGG + Intronic
976629933 4:87225701-87225723 TATTTTAGGTAGTTTGGGGGTGG + Intronic
976788494 4:88850256-88850278 TATTTTAAGAAAATTGTGGCCGG + Intronic
978634519 4:110788509-110788531 TCTTTTAAGTAGTTATTTGCAGG + Intergenic
981503295 4:145475104-145475126 TCTTCTAAGTAATATGTGGGTGG - Intergenic
982509994 4:156270270-156270292 TTTTTTAGGCAGTTTGGGGCTGG + Intergenic
983142253 4:164165611-164165633 TCTATTAAGTAGTTGGTGCCTGG + Intronic
983444950 4:167838232-167838254 TCACTGAAGTAGTTTGTGCCTGG - Intergenic
983474763 4:168199744-168199766 TCCTTGAAGTAGTTAGTAGCTGG - Intergenic
984017157 4:174440612-174440634 TCTTTTAAGAAGTTTTAGGTTGG + Intergenic
985571929 5:651643-651665 TCTTTTAAGAATTGTGTGCCGGG + Intronic
987281233 5:16415613-16415635 TCTTTTCATTAGTTAGTGACAGG + Intergenic
987767890 5:22258443-22258465 TCTTTTAAGAGGTTGGTGGTGGG - Intronic
988414329 5:30927081-30927103 TCTTTTAAGTAATATTTGGCAGG - Intergenic
989478594 5:41902723-41902745 TCTTTTAAGTAGTTTAAGAATGG + Intergenic
991990941 5:72338493-72338515 TCTTTTAAGTGGCTTGAGGGAGG + Intronic
993397546 5:87409217-87409239 TCTTTTGAGTATTTTTTGGGAGG - Intronic
993488671 5:88518603-88518625 TCTTTTATGTAGCATGTGGTAGG - Intergenic
993963794 5:94334778-94334800 TTTAAAAAGTAGTTTGTGGCCGG - Intronic
996307897 5:122071151-122071173 TTTATTAAATAGTATGTGGCAGG + Intronic
996448240 5:123583839-123583861 TTTTTTAATTAGCTGGTGGCTGG - Intronic
997807010 5:136927984-136928006 TCTTTTAAGTATTTGGGGGGAGG + Intergenic
998422464 5:142000227-142000249 TTTTTTAACTATTTTGAGGCTGG - Intronic
999885327 5:155916606-155916628 TCTTTTAAGTTGCTTCTAGCAGG + Intronic
1000677921 5:164145227-164145249 TCTTTTACGTACTTTTTGGGGGG + Intergenic
1000934237 5:167288601-167288623 TTTGTTGAGTAGTTTGTGTCAGG + Intronic
1002794418 6:460133-460155 TCTTATAAGTTGTTTGTTTCTGG + Intergenic
1003037160 6:2652266-2652288 TCTTTTAATTTTTTTTTGGCCGG - Intergenic
1003075948 6:2983763-2983785 TCTTTTAAAATGTTTGTTGCTGG - Intergenic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1011105899 6:83781064-83781086 TCATGTAAGTAGTTAGTGGTAGG - Intergenic
1011542996 6:88453076-88453098 TATTTAAAGTAGTATATGGCTGG + Intergenic
1011947824 6:92928804-92928826 TCTTTTAAATATTTTGTGTGTGG + Intergenic
1011995514 6:93582015-93582037 TCTTTTAAGTGGGCGGTGGCAGG + Intergenic
1013115512 6:107100903-107100925 TCTCTTAAGAAATTTCTGGCCGG + Intronic
1013219356 6:108063686-108063708 TCTGTCAAGTGGTGTGTGGCAGG - Intronic
1015248575 6:131103251-131103273 ACTCTTAAGTAATTTGGGGCTGG - Intergenic
1015374645 6:132495723-132495745 TCTTTTAATTAGTTAGGGTCTGG - Intronic
1015506983 6:133998835-133998857 TCCTTTAAACATTTTGTGGCTGG - Intronic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018533204 6:164789748-164789770 TCTTTCAAATGGTTTATGGCTGG + Intergenic
1018634216 6:165846669-165846691 TCCTTTAAGCGGTTTGTGGAAGG + Intronic
1019801362 7:3090699-3090721 TCTTTGTAGAAATTTGTGGCTGG - Intergenic
1021917389 7:25448418-25448440 TCCTGTAAGTAGTATATGGCTGG + Intergenic
1022724855 7:32972014-32972036 TTTTTAAAGTAGTTTCTTGCCGG + Intronic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1023978145 7:45048164-45048186 TCTTGGAAGTGGTTTGTGGATGG + Intronic
1025048743 7:55715813-55715835 TTTTTAAAGTAGTTTCTTGCCGG - Intergenic
1025781510 7:64605928-64605950 CCTTTTAAGTATTTTGAGGCGGG + Intergenic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1028582241 7:92420424-92420446 TCTTTAAAATATTTTCTGGCCGG + Intergenic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1030076054 7:105737824-105737846 ACTTTTAAGAATTTTGTGGCTGG + Intronic
1032180631 7:129673841-129673863 TTTTTTAAGCTGTTTTTGGCTGG + Intronic
1032769471 7:135035347-135035369 TCTTGTAAGAAGTTTAAGGCAGG + Intronic
1032783303 7:135181848-135181870 TCTTTTAAGCATTTTGAGGCAGG - Intergenic
1033790118 7:144782141-144782163 TCCTTTAACTAATATGTGGCTGG - Intronic
1034096356 7:148411570-148411592 TCTTTTTTATAGTTTGTGGTTGG + Intronic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1035201928 7:157273195-157273217 TGTTTTAAATAGGGTGTGGCAGG - Intergenic
1036944743 8:13084304-13084326 TCTTTGAAGAATTTTGGGGCAGG - Exonic
1036961186 8:13245996-13246018 ATTTTAAAATAGTTTGTGGCTGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1040098133 8:43468622-43468644 TCTTTAAAGTGTTTTGTGTCTGG + Intergenic
1041623031 8:59995495-59995517 ATTTTTCAGTAGTTTGTGGAAGG - Intergenic
1042213849 8:66409102-66409124 TCTTGTAAGTAGCATGTAGCTGG - Intergenic
1042446016 8:68885924-68885946 TCTTTTAAGTAATTTGTTTTGGG - Intergenic
1042479693 8:69289550-69289572 TCTTTCCAGTAGTTTGGGGAGGG - Intergenic
1043237344 8:77884702-77884724 TCTTTAAAGTAGTCTGTGGTAGG + Intergenic
1044782173 8:95754386-95754408 TCTTTGAAATAGCTTATGGCTGG - Intergenic
1045531619 8:102990402-102990424 TCTTTTAAGGAGGTTTTGGAGGG + Intergenic
1046939006 8:119913216-119913238 TCTTTAAACTAGATTCTGGCTGG - Intronic
1047458569 8:125039692-125039714 TCTTTTAAGTTATTTTTGGGTGG - Intronic
1048144503 8:131827317-131827339 TCTTTTATGTAGCTTTTGTCTGG - Intergenic
1048713720 8:137243352-137243374 CATTTAAAGTAGTTTGTAGCGGG + Intergenic
1050705287 9:8389764-8389786 TCTTTTATCTAGTTTTTGCCTGG - Intronic
1052427227 9:28321367-28321389 TCTTTTATGTAGTTTCTGCCTGG - Intronic
1052729022 9:32263825-32263847 TATTTTAATGAGTTTTTGGCAGG + Intergenic
1052958374 9:34272918-34272940 TTTTTAAAGTTCTTTGTGGCTGG - Intronic
1054996016 9:71390545-71390567 TCTTTTAGGTAGTTTATAGCTGG + Intronic
1055822603 9:80285564-80285586 TCTTTTGAGTTGTTAGTGGTTGG + Intergenic
1056387055 9:86105815-86105837 TATTTAAAATAGTTTGGGGCTGG + Intergenic
1056979987 9:91300756-91300778 TGTTTTAAGTAGTTTGGGGCTGG - Intronic
1057166584 9:92931980-92932002 TTTTTTAAGTTGTTTATAGCAGG + Intergenic
1058933636 9:109747240-109747262 TCTTTCAAGTGGTTTATGTCAGG + Intronic
1060502312 9:124169859-124169881 TCTTTTAATTAGTGTTTGGAAGG + Intergenic
1061116491 9:128616468-128616490 TCTTAAAAGACGTTTGTGGCCGG + Intronic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1185885459 X:3778293-3778315 TCTTTTAAGAAGTGTGAGACTGG - Intergenic
1186755655 X:12668899-12668921 TCTTAAAAGTAGTTTCAGGCCGG - Intronic
1189547143 X:42053265-42053287 TCTATAAAAAAGTTTGTGGCCGG + Intergenic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190826688 X:54024366-54024388 TCTTTGAAGAAGTTTTAGGCAGG - Intronic
1193019313 X:76773644-76773666 TCTCTTCAGTTGTTTGTGTCTGG - Intergenic
1193830467 X:86283072-86283094 TCTTTTAAGAAGTGTCGGGCCGG - Intronic
1195092603 X:101475671-101475693 TCTTTTTATTAGTTTTTGCCTGG - Intronic
1195375730 X:104226023-104226045 TGTTTTAAATATTTTGTAGCAGG - Intergenic
1195861351 X:109386667-109386689 CCTTTTAAGTACTTTGTGCTTGG - Intronic
1197712600 X:129682572-129682594 TCCTCTAAGTAGTCTGTGGCTGG - Intergenic
1198421439 X:136473363-136473385 TCTTCTAAGCAGTTTAGGGCTGG + Intergenic
1199133872 X:144228923-144228945 TCTTGTAAGTAGTATATAGCTGG + Intergenic
1200425696 Y:3018325-3018347 TCCTTTAAGTAGTCTGTGGTAGG - Intergenic
1201574310 Y:15445616-15445638 TCTTTTGAGCAGTGTCTGGCAGG - Intergenic
1201646956 Y:16244472-16244494 TTTTTTAAGTAGTTTGGGTTTGG - Intergenic
1201655855 Y:16340830-16340852 TTTTTTAAGTAGTTTGGGTTTGG + Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic