ID: 1084111351

View in Genome Browser
Species Human (GRCh38)
Location 11:67015920-67015942
Sequence GAGGCCTGGCCAGGTCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084111351 Original CRISPR GAGGCCTGGCCAGGTCACAC TGG Intronic
900139312 1:1132853-1132875 GAGCCCTGGCCGGGTCCCACTGG - Intergenic
900407470 1:2498902-2498924 GAGGCCTGGGCAGGGCACCCGGG - Intronic
900541713 1:3206207-3206229 GTGGCCTGGCCAGGTCAGTGTGG - Intronic
900898948 1:5503921-5503943 GGGGGCAGGCCACGTCACACAGG - Intergenic
900954147 1:5876358-5876380 GAGGCCTGGCCTGATCCCACAGG - Intronic
901216052 1:7555998-7556020 GGGGGCAGGCCACGTCACACAGG + Intronic
901301119 1:8200655-8200677 GAGGACAGGCCAGGCCACCCTGG + Intergenic
902623618 1:17664454-17664476 GAGGGCTCTCCAGGTCCCACAGG - Exonic
902787851 1:18744903-18744925 TAGGCCTGGCCAGTTTCCACAGG - Intronic
902869571 1:19306048-19306070 GAGGGCAGCCGAGGTCACACTGG + Exonic
902983615 1:20142324-20142346 CAGGCTTGCCCAGGTCCCACAGG - Intronic
903070461 1:20724532-20724554 GAGCCCTGCCCAGGGCCCACAGG - Exonic
904057888 1:27684334-27684356 GAGGCCAGGCCAGGAGACTCTGG + Intergenic
904758596 1:32784419-32784441 TAGGCAGGGCCAGGTCACAAAGG - Intronic
904832816 1:33316300-33316322 GAGCCGGGGCCAGGTCACCCAGG + Intronic
904917649 1:33981941-33981963 GAGGCCTGTGGAAGTCACACTGG + Intronic
905478917 1:38247944-38247966 GTTGCCTGGACAGATCACACGGG + Intergenic
906822537 1:48944604-48944626 GAGGCCTGGCGTGGGCACGCTGG - Intronic
907936414 1:59046167-59046189 GATGCAGGGCCAGGTCACACAGG - Intergenic
910447568 1:87314189-87314211 GAGGCCCGGCCCAGTCTCACAGG + Intergenic
911049197 1:93655138-93655160 GAGGCAGGGCCAGGTCACAAGGG + Intronic
911153960 1:94621481-94621503 GTGGCCTGGCCAACTCACACAGG - Intergenic
911669169 1:100588812-100588834 GAGGCAGGGCCAGGTCACATGGG - Intergenic
913283581 1:117208133-117208155 GAGGTCACACCAGGTCACACTGG - Intronic
915342984 1:155186300-155186322 GAGTCCTGGCCAGCTCTCAAAGG + Intronic
918050611 1:180969573-180969595 AAGCCCTGGCGAGGTGACACTGG + Intergenic
918061161 1:181062432-181062454 AAGCCCTGGCGAGGTGACACTGG + Intergenic
918180007 1:182079204-182079226 AAGTCCTGGCCAGATCACATAGG + Intergenic
919748321 1:201022138-201022160 GAGGCCTGGCCAGGTGGCCGTGG + Intronic
919759591 1:201089168-201089190 GAGGGCTTGCCAGTCCACACAGG - Intronic
920175452 1:204098701-204098723 GAGGACTGGCCAGAACACAGAGG + Intronic
920776238 1:208940208-208940230 CAGGCCAGGCCAGGCCACATGGG + Intergenic
921328828 1:214015215-214015237 GAAGCTTGGCCATATCACACCGG + Intronic
922505590 1:226123712-226123734 CAGGCCTGGCCAGGGCCCAAAGG + Intergenic
923779459 1:237009207-237009229 GACGCCAGGCCAGCTCACACTGG - Intergenic
924160615 1:241227917-241227939 GAGGAATGGCAAGGTCACATTGG - Intronic
1062872971 10:922520-922542 GAGGTCTTGCCATGTCACCCAGG - Intronic
1063431358 10:5991697-5991719 GTGGCCTGGGCATGTGACACAGG - Intergenic
1063454610 10:6174411-6174433 CCTGCCTGGCCACGTCACACTGG + Intronic
1064594326 10:16928176-16928198 GAAGCCTGCCCTGGTTACACTGG + Exonic
1067011074 10:42714449-42714471 GAAGCCTGCCCTGGTTACACTGG + Intergenic
1067174223 10:43931101-43931123 GAGGCCAGGCCAGCTCCCAAAGG + Intergenic
1067312523 10:45127422-45127444 GAAGCCTGCCCTGGTTACACTGG - Intergenic
1067337856 10:45379128-45379150 CAGGACTGGGCAGGTCCCACAGG - Intronic
1067755401 10:49000972-49000994 GAGGCTTGGAGAGGTCACACAGG - Intergenic
1068919523 10:62467646-62467668 AAGTCCAGGCCAGGTCACAATGG - Intronic
1069907553 10:71740673-71740695 CAGGGCTGGCCAGGCCACCCAGG + Intronic
1070300204 10:75198094-75198116 GAAGCCTGGGAAAGTCACACAGG - Intergenic
1070757471 10:79002366-79002388 GAGGACTGGGGAGGTCACAGAGG - Intergenic
1070889129 10:79929086-79929108 GTGACTTGCCCAGGTCACACAGG - Intergenic
1073018263 10:100419431-100419453 GAGGTCTGGCCACGTTACCCAGG - Intergenic
1075560465 10:123464492-123464514 CAGGCCAGGCCAAATCACACAGG - Intergenic
1076017440 10:127039548-127039570 AAGGGCTGGACAGGTCACCCAGG - Intronic
1076166276 10:128285126-128285148 GGGGCCTGGCTAGGTCACCAAGG + Intergenic
1076366193 10:129922351-129922373 GGGGCCAAGCCAGGCCACACAGG + Intronic
1076412607 10:130262657-130262679 GAGGCCAGGCCAGGTGCCAAGGG - Intergenic
1076534475 10:131167984-131168006 AAGCCCTGGCCAGGTCTCATGGG + Intronic
1076848773 10:133082820-133082842 GAGGCCTGGCCGAGGCACCCTGG + Intronic
1076861731 10:133141094-133141116 GGGGCCTCCCCAGGTCACAGGGG + Intergenic
1077237538 11:1488946-1488968 GTGGCGGGGCCAGGCCACACTGG - Intronic
1077560689 11:3258404-3258426 GAGCCCTGCCCAGGTACCACTGG + Intergenic
1077566585 11:3304232-3304254 GAGCCCTGCCCAGGTACCACTGG + Intergenic
1078142406 11:8701966-8701988 GAAGGCTGGCCAGCCCACACCGG - Intronic
1079131052 11:17747228-17747250 GTGACCTGCCCAGGACACACAGG - Intronic
1081535851 11:43995768-43995790 GGGGCCTTGCCAGACCACACAGG + Intergenic
1083734851 11:64674068-64674090 GAGGTCTTGCCATGTCACCCAGG + Intronic
1083776986 11:64898857-64898879 GAGGCCTGGCCAGGTAAGCAGGG + Intronic
1083996397 11:66275142-66275164 GAAGCCTGGTCATATCACACTGG - Intronic
1084111351 11:67015920-67015942 GAGGCCTGGCCAGGTCACACTGG + Intronic
1084230603 11:67750013-67750035 GATTCCTAGCCATGTCACACAGG + Intergenic
1084443349 11:69188776-69188798 GAGGTCAGGACAGGTCTCACAGG - Intergenic
1084497421 11:69513181-69513203 GCTCCCTGGCCAGGTCACAGTGG + Intergenic
1084609515 11:70193301-70193323 CAGGCCTGGCAATGACACACTGG + Intergenic
1084652834 11:70499232-70499254 GTGGCCCAGCCTGGTCACACTGG - Intronic
1084693714 11:70741601-70741623 GGGGCCTGGGGAGGACACACAGG - Intronic
1084938059 11:72597671-72597693 GAGGCCTGGCCTGGGAACACAGG + Intronic
1085531930 11:77197096-77197118 GAGGCGTGGGCAGGGCAGACGGG - Intronic
1085923060 11:80981865-80981887 GAAGCCTGGCCATCTCCCACCGG - Intergenic
1087279734 11:96197078-96197100 GTGGCCTGCCCAGGTCACTAAGG + Intronic
1089175748 11:116547753-116547775 CAGGCCAGGCCAGGGCCCACAGG - Intergenic
1089347800 11:117802263-117802285 GAGGCCTGGTCAGGGAAAACTGG - Intronic
1089773051 11:120816900-120816922 GAGGCCAGCCCAGGCCACAGAGG + Intronic
1090088498 11:123672675-123672697 AAGGCCTGGCCAGCTGGCACTGG - Intergenic
1090382168 11:126335130-126335152 GTGGCCTGGCCACGTCTCCCAGG - Intronic
1090805752 11:130201141-130201163 GAGGCCTGGAAGGGTCACATGGG + Intronic
1091561344 12:1616371-1616393 CAGGCCTGGGCAGGTTACAGAGG - Intronic
1091655207 12:2341110-2341132 GAGGCCTGTCCAGGTGACAAGGG - Intronic
1092899147 12:13042271-13042293 AAGGAATAGCCAGGTCACACAGG - Intergenic
1096885981 12:54719738-54719760 CAAGGCTGGCCATGTCACACGGG - Intergenic
1098704964 12:73675518-73675540 AAGTCCTGGCCAGGGCAAACAGG + Intergenic
1099308020 12:80982516-80982538 TAGACCTGTGCAGGTCACACAGG + Intronic
1099337755 12:81386081-81386103 GAGGCCTTGCTATGTCACCCAGG - Intronic
1100724681 12:97396124-97396146 GAGGTCTGGCTAGGTTACCCAGG - Intergenic
1100861230 12:98809557-98809579 GTGGCTTGCTCAGGTCACACAGG + Intronic
1101790477 12:107922065-107922087 GAGTCCTGGCCAGGGCAATCAGG + Intergenic
1101965951 12:109281888-109281910 GAGGCTTGCTAAGGTCACACAGG - Intronic
1102028566 12:109727177-109727199 GAGGCCAGGCTGGGACACACTGG + Intronic
1102227028 12:111235985-111236007 GGGGCCGTGCCAGGTCCCACTGG - Intronic
1102890998 12:116558454-116558476 TGGGCCTGGGCAGGTCAAACAGG + Intergenic
1103242040 12:119421753-119421775 GAGTCCTGGCCCTGTCACTCAGG - Intronic
1103480769 12:121248533-121248555 GGGGCCTGGCCAGGACAGGCCGG - Intronic
1104906879 12:132218257-132218279 GAGGCCTGGGCTGGGAACACAGG - Intronic
1106182632 13:27381753-27381775 CAGGCCAGGCCAGGCCGCACCGG - Intergenic
1107586696 13:41856796-41856818 AAGGCCTGGCTATGTCACCCAGG - Intronic
1110281533 13:73699358-73699380 GGGGTCTTGCCTGGTCACACAGG - Intronic
1112123176 13:96435460-96435482 GAGGCCTTTCCAGATCCCACTGG + Intronic
1113614621 13:111671505-111671527 GGGGCCAGGGCAGGTCACAGAGG + Intronic
1113620088 13:111756419-111756441 GGGGCCAGGGCAGGTCACAGAGG + Intergenic
1113719624 13:112544974-112544996 GAGGCCTGGCCATCTGAAACAGG - Intronic
1113826436 13:113258180-113258202 GAGGCCTTGCCATGTTACCCAGG + Intronic
1113841842 13:113365022-113365044 GGGGCCTGTCCAGGTCGCCCTGG - Intergenic
1115457695 14:33623679-33623701 GAGGCCTTGGCAGGTCACAGAGG - Intronic
1118579229 14:67276816-67276838 GAGACCGGGCCAGGTCATCCAGG - Intronic
1119029311 14:71179305-71179327 GAGGCCTTGGCAGGTAATACTGG + Intergenic
1119087850 14:71753570-71753592 GAGGCCTGGGCAAATGACACTGG + Intergenic
1119856938 14:77907987-77908009 GAGGCCTCACCTGGACACACAGG - Intronic
1120897786 14:89549722-89549744 AAGGCATGGCCAAGTCGCACAGG + Intronic
1121637495 14:95463617-95463639 GAAGCCTGCCCATGCCACACGGG + Intronic
1121729788 14:96178454-96178476 GAGGTCTGGCCATGTTACCCAGG - Intergenic
1122855327 14:104557231-104557253 GAGGCCTGGCAAAGTCCCTCAGG + Intronic
1123038913 14:105482541-105482563 GGGACCTGGCCAGGAGACACGGG - Intergenic
1124018957 15:25902740-25902762 GAGCCCAGGCCAGGTGAGACCGG - Intergenic
1124373108 15:29114549-29114571 GAGGCCTGGCCAGTGCGCAGCGG + Intronic
1128695074 15:69755709-69755731 GAGGGCTGGCCTGGTTACAAGGG - Intergenic
1130297387 15:82656823-82656845 GGGGCCTGCCCAGCACACACAGG - Intergenic
1130367274 15:83251929-83251951 GAGGCCAGGCATGGTCACAAAGG + Intergenic
1130978029 15:88792203-88792225 CAGGCAGGGCCAGGTCACTCAGG + Intergenic
1132286574 15:100667914-100667936 AAGGCCTGGCCAGGCCACTTCGG + Intergenic
1132679444 16:1133750-1133772 GACACCTGCCCAGGTCACGCAGG + Intergenic
1132997396 16:2830352-2830374 GGGGCCCGGCAAGGTCACACTGG + Intronic
1134247380 16:12549814-12549836 GAGGCAAGGCCTGGCCACACAGG - Intronic
1135328568 16:21543205-21543227 AAGGCCTTGCCCGGGCACACAGG - Intergenic
1135831633 16:25779361-25779383 GTGGCTTGGCCAAGTCACACAGG + Intronic
1136116949 16:28100731-28100753 GAGGCCTGGTCACCTGACACAGG + Intronic
1136338916 16:29629178-29629200 AAGGCCTTGCCCGGGCACACAGG - Intergenic
1136776241 16:32873347-32873369 CAGGCCTGGCCAGGCCAAGCAGG - Intergenic
1136894374 16:33988165-33988187 CAGGCCTGGCCAGGCCAAGCAGG + Intergenic
1137545873 16:49403039-49403061 GAGGCCTGGCCTGACCACATTGG - Intergenic
1138560299 16:57797337-57797359 GAGGCGTGGGCAGGTCGCCCTGG - Intronic
1138646956 16:58432497-58432519 GAGGCCTGGCAAGGTGGCAGGGG + Intergenic
1139776531 16:69320153-69320175 GCTGCCTGGCCAGCTCAAACAGG - Exonic
1141122697 16:81373323-81373345 CAGGCATAGCCAGGTCACAGTGG - Intronic
1141128848 16:81420748-81420770 GAGGCCTCTCCAGTTCTCACCGG + Intergenic
1141930775 16:87201277-87201299 GAGGCTGAGCCACGTCACACTGG + Intronic
1142022381 16:87791829-87791851 GAGGCCAGGCCCCTTCACACGGG + Intergenic
1142244570 16:88963860-88963882 GAGGCCTGGCCTGGCCACACGGG + Intronic
1142408239 16:89902973-89902995 GAGGCCTGGCCAGGCCCCTCTGG - Intronic
1203078656 16_KI270728v1_random:1135456-1135478 CAGGCCTGGCCAGGCCAAGCAGG - Intergenic
1142717586 17:1755446-1755468 GAGGGCTGGCGAGGTCAGAGGGG - Intergenic
1145753048 17:27368875-27368897 GAGCCCTAGCCAGGTCAAACAGG + Intergenic
1145760894 17:27425146-27425168 GGGGCCGGGCCAGGGGACACGGG - Intergenic
1145787796 17:27605341-27605363 GAGCCCTAGCCAGGTAACAGGGG - Intronic
1146949160 17:36893729-36893751 GAGGCCTGGCCTGGCCACGATGG + Intergenic
1148215086 17:45829955-45829977 GCTGACTGGCCAAGTCACACAGG - Intronic
1148279948 17:46339984-46340006 GAGGCCTGGAGAGGTGTCACTGG + Intronic
1148302166 17:46557840-46557862 GAGGCCTGGAGAGGTGTCACTGG + Intronic
1148437932 17:47696654-47696676 GAGGCCTGGGCTGGGCACCCGGG + Intronic
1150614239 17:66756504-66756526 GAGGGCTGGACATGGCACACTGG - Intronic
1152012158 17:77725282-77725304 GAGGCCTGCTGAGGACACACTGG - Intergenic
1152430190 17:80244501-80244523 AAGGCGTGTCCTGGTCACACAGG + Intronic
1152438235 17:80289005-80289027 GAGGCCTCGCCCGGCCACTCGGG - Intronic
1152970719 18:158712-158734 GAGGCCAGGACAGGGCTCACCGG - Exonic
1157289483 18:46399613-46399635 CAGGCCTGGCCAGGCAGCACTGG - Intronic
1157615235 18:48983150-48983172 CAGCCCTGTCAAGGTCACACAGG + Intergenic
1158041386 18:53098981-53099003 GAGGTCTTGCTATGTCACACAGG - Intronic
1158519195 18:58156652-58156674 GAGAGCTGGCCAGGTAGCACTGG - Intronic
1160452000 18:78972736-78972758 GATGCCTGGCCTGGGCAAACCGG - Intergenic
1160555549 18:79722868-79722890 GAGGCGTGGCCAATCCACACAGG - Intronic
1160675824 19:390799-390821 GAGGCCTTGCCAGGGCTCAGAGG - Intergenic
1161165121 19:2782802-2782824 GAGGCTGGGCAAGGTCACCCAGG + Intronic
1162126782 19:8503677-8503699 GAGGCCTCACCCGGTCACATGGG - Intergenic
1162149958 19:8638036-8638058 GTGGCCTGGCAAGGTCATGCTGG - Intergenic
1162877977 19:13635084-13635106 GAGGCCTGGCTCTGTCACCCAGG + Intergenic
1163210850 19:15839040-15839062 GAGGCCAGGCCAGGCAAGACTGG + Intergenic
1163233866 19:16020161-16020183 GAGGCCTGCCCAGGGCACTGAGG - Intergenic
1163328064 19:16618062-16618084 GAAGCCAGGCCAGGAAACACAGG + Intronic
1163347167 19:16750478-16750500 GAGGTCTGGCTATGTCACCCAGG + Intronic
1163676173 19:18656373-18656395 GCGGGCTGCCCAAGTCACACCGG - Intronic
1163817861 19:19477867-19477889 CATGGCTGGCCAGGTCACCCAGG - Intronic
1165015905 19:32879837-32879859 GAGTGCTGGCCAGGTCACAGTGG - Intronic
1165242813 19:34481569-34481591 GAGGCCGGGCCAGGACGCAGGGG - Intergenic
1165900033 19:39165044-39165066 GGGTCCAGGACAGGTCACACAGG + Intronic
1166138164 19:40790062-40790084 GAGGCCTCCCCAGGGCCCACAGG - Intronic
1166434112 19:42752623-42752645 GAGACCTGGCCTGGACACATGGG + Intronic
1166437258 19:42777952-42777974 GAGACCTGGCCTGGACACATGGG + Intronic
1166456370 19:42943348-42943370 GAGACCTGGCCTGGACACATGGG + Intronic
1166466162 19:43032619-43032641 GAGACCTGGCCTGGACACATGGG + Intronic
1166472304 19:43088687-43088709 GAGACCTGGCCTGGACACATGGG + Intronic
1166483439 19:43192636-43192658 GAGACCTGGCCTGGACACATGGG + Intronic
1166493067 19:43275676-43275698 GAGACCTGGCCTGGACACATGGG + Intergenic
1167213235 19:48146889-48146911 CGGGCCTCGCCAGGTCACACAGG - Intronic
1168297589 19:55384933-55384955 GAGCCCTGGGGAGGTGACACAGG + Intergenic
926089322 2:10040183-10040205 AAGACTTGGCAAGGTCACACCGG + Intergenic
926168256 2:10534917-10534939 AAGCCCTGGCCCAGTCACACGGG - Intergenic
926226877 2:10973074-10973096 GTGGCCAGTACAGGTCACACAGG + Intergenic
926429590 2:12772454-12772476 GAGGCTTGGGGAGGTCACACCGG + Intergenic
927237085 2:20884275-20884297 GAGGCCTGGCCAAATCACCAGGG - Intergenic
927783214 2:25955409-25955431 GAGGCCAAGCCATGTCACTCAGG + Intronic
928419634 2:31128314-31128336 GAGGCATGGCCAGGACACCCCGG + Intronic
928752612 2:34488132-34488154 GAGGCCTGGCAAGGTAGCTCAGG - Intergenic
929083020 2:38139584-38139606 GAGGCCAGGGCAGGACACAGTGG + Intergenic
934043350 2:88148022-88148044 GACCCCTGGGCAGGGCACACAGG - Intergenic
934935219 2:98460400-98460422 GAGGCAGGGCCAGATCACCCGGG + Intronic
935578278 2:104733690-104733712 GCTCCTTGGCCAGGTCACACGGG - Intergenic
935713293 2:105917925-105917947 GAGGCCTTGCTGGGTGACACTGG + Intergenic
936050838 2:109222656-109222678 AAGGCCTGGCCAGGCTCCACAGG - Intronic
936069116 2:109353574-109353596 CAGCCCTGGCCAGGTGACACAGG - Intronic
937252531 2:120533768-120533790 GGGGCCTGGCCAGGCCAAGCAGG + Intergenic
937311420 2:120905615-120905637 GAGGCCTGCCCAGGTCAGCCTGG - Intronic
938672709 2:133601025-133601047 AGGGCCCGGCCAGGTCACAGAGG - Intergenic
938740458 2:134226832-134226854 AGGGGCTGGGCAGGTCACACAGG + Intronic
939714607 2:145568613-145568635 GAGACCTTGGCAGGTCCCACAGG + Intergenic
941035782 2:160567791-160567813 GAGTCCTGGCTAGTTCCCACTGG + Intergenic
943742654 2:191427108-191427130 GAGGCCAGGCCAGAATACACAGG - Intergenic
945041834 2:205749077-205749099 AAGACCTGGCCTGGCCACACTGG + Intronic
945289390 2:208112523-208112545 GAGGCAAGGCGAGGTCTCACAGG + Intergenic
945381359 2:209145322-209145344 GAGGCAAGGCCAGGGCTCACAGG - Intergenic
946143938 2:217714425-217714447 CCGGCCTGGCCATGTGACACGGG + Intronic
947196725 2:227575081-227575103 GAGGCCAGACCAGGTAAGACAGG - Intergenic
947246687 2:228056316-228056338 GAAGAATGGCCAGGTCACAGAGG + Intronic
947414900 2:229884765-229884787 GAGGCCAGCCCAGGCAACACAGG + Intronic
948281231 2:236749303-236749325 GAGGCATGGCCCCGTCACCCTGG - Intergenic
948463778 2:238142719-238142741 GAGGCCTGCCCAGGACACGCGGG + Intronic
948808746 2:240464443-240464465 GTGGCCTGCACATGTCACACGGG + Intronic
948816053 2:240510887-240510909 GAGGCCTGGGCAGTGAACACAGG - Intronic
1170703754 20:18727135-18727157 GAGGCCTGGGCAGGGCCCATGGG + Intronic
1170898318 20:20436561-20436583 GGGCCCTGGCCAGGACACAAAGG + Intronic
1172944524 20:38676911-38676933 GAGGCCAGGCCAGCTCAGGCTGG + Intergenic
1174283197 20:49454090-49454112 GTGGCTTGACCAGGTCTCACGGG + Intronic
1174398263 20:50261134-50261156 GAGGCCAGGCCAGGCCACAGAGG - Intergenic
1175353841 20:58346368-58346390 GAGGCCTGGGCAAGTCACGTGGG - Intronic
1175743327 20:61435935-61435957 GGGGCAGGGCCAGGCCACACTGG - Intronic
1175919850 20:62445759-62445781 GAGCCCAGGCCAGGCCACGCTGG - Intergenic
1178622547 21:34189197-34189219 GAGGCCTGGCCATATCATAGAGG - Intergenic
1181021590 22:20106368-20106390 GAGGCATGGCCAGGTTTCCCTGG + Intronic
1181622429 22:24100241-24100263 CAGGCCTGGGCAGAGCACACAGG - Intronic
1181770051 22:25118739-25118761 GAGGCAGGGCCAGGTCGCACAGG - Intronic
1182041488 22:27241990-27242012 GAGGCCTGTCCAGCTCCCTCTGG + Intergenic
1182125300 22:27811522-27811544 CAGGCATGGCAAGGTCACCCGGG - Intergenic
1183320856 22:37164283-37164305 GAGACCTGGCCAGTGCACAAGGG + Intronic
1183407826 22:37639258-37639280 GAGGCCAGGACAGGTCAGAAAGG + Intronic
1183476699 22:38039558-38039580 GAGACCTGGGCAGTTCACCCAGG + Intronic
1183513836 22:38251674-38251696 GCTGCCTGCCCAGGTCCCACAGG + Intronic
1183667531 22:39254222-39254244 GCTGCCTGGGCTGGTCACACTGG - Intergenic
1184051012 22:42004634-42004656 GAAGCCTGGGCAGGGCACAGTGG + Intronic
1184479033 22:44736555-44736577 TAGGCCCAGCCTGGTCACACAGG - Intronic
1184617219 22:45646220-45646242 GAGGCCTTGGCAGGGCCCACGGG + Intergenic
1185002610 22:48255330-48255352 GAAGCCTGGTCTGGACACACAGG + Intergenic
1185091549 22:48778463-48778485 GAGGCCAGGGAAGGCCACACAGG + Intronic
949839483 3:8304541-8304563 GAGGTTAGGCAAGGTCACACAGG + Intergenic
950009863 3:9715375-9715397 CAGCCCTGCCCAGGTCACCCAGG + Intronic
950448957 3:13054988-13055010 GAGGCCTGGGCAGGACAGGCGGG - Intronic
950507539 3:13404619-13404641 GAGGCCAGGCTAGGACACAGGGG + Intronic
950568412 3:13785513-13785535 GAGGACGGGCCAGCTCACTCAGG - Intergenic
950874517 3:16258510-16258532 GAGGTCTTGCCCTGTCACACAGG + Exonic
951038405 3:17961102-17961124 TAGGCATGGCCAGGTCACATAGG - Intronic
953018540 3:39099678-39099700 GAGGCCAGGCCAGGCCCCTCAGG - Intronic
953385926 3:42505588-42505610 TAGGCCTGGCCAGGGCTCCCAGG + Intronic
955937652 3:64117337-64117359 GAGTCCTGGCCAGGGCAATCAGG + Intronic
958077112 3:88694700-88694722 AAGTTCTGGCCAGGTCAAACAGG + Intergenic
959957615 3:112256704-112256726 AAGTCCTGGCCAGGTCAATCAGG + Intronic
960065750 3:113370717-113370739 AAGTCCTGGCCAGGGCAAACAGG + Intronic
961467619 3:127091159-127091181 GTGGCCAGTGCAGGTCACACCGG + Intergenic
962142357 3:132804021-132804043 GAGGCCAGGCCAGGTCTCACAGG - Intergenic
962195037 3:133354353-133354375 GATGCCTGGCCAGGTCTCTTGGG - Intronic
962236163 3:133709414-133709436 GAGGGCTGGCCAGATCTCACTGG + Intergenic
964374624 3:156036966-156036988 CATGGCTGGCCAGGTCACTCTGG + Intergenic
965495498 3:169393251-169393273 GAGGACTGGCCAGAGCACCCTGG + Intronic
968452127 4:680748-680770 GAGGCCAGCCCTGCTCACACAGG + Intronic
968579924 4:1385091-1385113 GAGGCCTGGCATGGGCCCACTGG - Intronic
968977933 4:3831432-3831454 GAGGCCTGGCCTGGTCAACCTGG + Intergenic
969536122 4:7757060-7757082 TAGGCCATGCCAGGCCACACAGG + Intergenic
969657457 4:8506560-8506582 AGGGGCTGCCCAGGTCACACAGG - Intergenic
969968415 4:11021045-11021067 GCCTCATGGCCAGGTCACACAGG + Intergenic
972508883 4:39748486-39748508 CATGCCTGGCCAGGTAACAGTGG - Intronic
973945349 4:55949182-55949204 GAGGCCAGGCCGGGTCAGACCGG + Intronic
974034311 4:56804154-56804176 GAGGCCTGGCCATGTTGCCCAGG - Intergenic
974238601 4:59213163-59213185 GAGGCCCGGCGAGGTAAAACAGG - Intergenic
977486977 4:97661414-97661436 GAGGACTGGCCATGTCACAAAGG - Intronic
979997115 4:127444362-127444384 GATGCCTGGCCTGCCCACACTGG - Intergenic
986813413 5:11383576-11383598 TAGGCCAGGCCAGTCCACACTGG + Intronic
990981551 5:61606734-61606756 CAGGCCAGGCCAGAGCACACAGG + Intergenic
992592554 5:78310352-78310374 GTGGCTTGTCGAGGTCACACTGG - Intergenic
992640964 5:78767986-78768008 GAGGGCTGGTCAGGCCACTCAGG + Intronic
994137578 5:96305457-96305479 AAGTCCTGGCCAGGTCAATCAGG - Intergenic
994570308 5:101506212-101506234 CTGGCCTGCCCACGTCACACTGG + Intergenic
995348298 5:111146362-111146384 GATGCCTGGCCAAGTCACAGAGG + Intergenic
996190914 5:120540436-120540458 GAGGCCCGGCCAGGGCACATAGG - Intronic
997781425 5:136662705-136662727 GAGGTCTGCCTAGGTCACAGAGG - Intergenic
998154636 5:139777690-139777712 GAGGTCTGGCCATGTTGCACAGG - Intergenic
998321654 5:141237706-141237728 GAGGTCTTGCCATGTCACACGGG + Intergenic
999200192 5:149810718-149810740 CTGGTCTGGACAGGTCACACGGG + Intronic
1000252667 5:159510382-159510404 AAGGCCTGGCAGGGTCACTCTGG - Intergenic
1001804373 5:174570744-174570766 GACGACTGGCCACATCACACAGG + Intergenic
1001952791 5:175827874-175827896 CAGGGCTGGCCAGGGCACGCAGG - Intronic
1003117055 6:3289883-3289905 GCGGCCTGCCCAGGGCTCACAGG - Intronic
1003118111 6:3296871-3296893 GAGGCCTGTCCAGGTACCAAGGG + Intronic
1003724907 6:8750167-8750189 GAGGCCTGACCAGTTTACATTGG - Intergenic
1004481419 6:16023186-16023208 GGTCCCTGGCCAGCTCACACTGG + Intergenic
1006599794 6:35217756-35217778 GTGCCCTGTCCAGGCCACACTGG + Intronic
1007463072 6:42032109-42032131 GAGGTCTTGCCCTGTCACACAGG + Intronic
1009384508 6:63072272-63072294 AAGTTCTGGCCAGGTCACTCAGG - Intergenic
1010206100 6:73323652-73323674 GAGGCTTGGGCAGGGCCCACAGG + Intergenic
1010259246 6:73796276-73796298 GAGGCCAAGCCAGATCACCCAGG - Intronic
1011624581 6:89272691-89272713 GAGCCCTGACCAGGGAACACAGG + Intronic
1012356746 6:98323550-98323572 CAGGCCTGAAAAGGTCACACAGG - Intergenic
1012845343 6:104381249-104381271 GTGGCATGGCCAGCTCACATAGG + Intergenic
1013184506 6:107746186-107746208 TAGCCAGGGCCAGGTCACACAGG + Intronic
1013189421 6:107789551-107789573 GATACATGGGCAGGTCACACAGG + Intronic
1017547772 6:155470001-155470023 TAGCCCGGGCCAGGTCACCCAGG + Intergenic
1017711110 6:157168966-157168988 GAGGACTGGCCATTTCACATTGG + Intronic
1017902992 6:158734425-158734447 GAGTGGTGGGCAGGTCACACAGG - Intronic
1018339650 6:162838252-162838274 GAGGCCTGTCCATGACCCACTGG - Intronic
1019348019 7:539948-539970 GAAGCCTGGCCAGGTTCCAGTGG + Intergenic
1019513580 7:1430088-1430110 GAGGCCTGGGCAGGGCAGATGGG + Intronic
1019527438 7:1487097-1487119 GAGGCCTGGGCAGGCGACAGTGG + Exonic
1019701467 7:2476574-2476596 GAGACCTTGCCAAGTCACCCGGG - Intronic
1021054149 7:16026453-16026475 GGGGCCTGGCCAGTTGACCCTGG + Intergenic
1023056109 7:36291381-36291403 GAGGCCTGGCCTGGTGACTTTGG + Intronic
1023434121 7:40124812-40124834 GGGGCTTGGCCATGTCACCCAGG - Intergenic
1023975536 7:45027138-45027160 GGGGCTTGGGCAGGGCACACCGG - Intronic
1024246921 7:47477640-47477662 GTGACCTGGCCAGGTGCCACAGG + Intronic
1024250996 7:47505546-47505568 GAGGTGTGGCCAGGTCACAGGGG + Intronic
1024607259 7:51032111-51032133 CAGAGCTGCCCAGGTCACACTGG + Intronic
1024946027 7:54808155-54808177 ATGGCCTGGCCAGGCCACATAGG - Intergenic
1026775059 7:73226201-73226223 GAGGCTTGGCGGGGTCACAGGGG - Intergenic
1027015915 7:74779572-74779594 GAGGCTTGGCGGGGTCACAGGGG - Intronic
1027072114 7:75166365-75166387 GAGGCTTGGCGGGGTCACAGGGG + Intergenic
1029416973 7:100449297-100449319 GATTCTTGGCCAGGACACACTGG - Intergenic
1030686527 7:112492688-112492710 GAGTCCTGGCCAGATGACCCTGG - Intergenic
1032501103 7:132400569-132400591 GTGGCCTGGCCCATTCACACAGG - Intronic
1032812372 7:135433547-135433569 GAGGCCTCGCCATGTTACCCAGG + Intronic
1033359240 7:140626427-140626449 GAGACCAGGACAGATCACACCGG - Intronic
1034270161 7:149799842-149799864 GAGGCTGGGCCAGGACTCACGGG - Intergenic
1035224044 7:157424007-157424029 GTGGCCTCGTCAGGACACACAGG - Intergenic
1035698896 8:1622925-1622947 GTGGCCCCGCCAGGTGACACAGG - Intronic
1036435543 8:8729767-8729789 GATGCCTGGCCAGGGTAGACAGG + Intergenic
1037172746 8:15913003-15913025 GAGGCCTGCCCACATCACAGAGG + Intergenic
1038865701 8:31436765-31436787 GAGGTCTGGCCAGGAGACCCTGG - Intergenic
1039470133 8:37808269-37808291 GATGCCTGGCCAGGCCAGCCAGG + Intronic
1041241753 8:55854378-55854400 CATGCCTTGCCAGGTCAGACAGG + Intergenic
1049001216 8:139826587-139826609 GAGACCTTGCCAGGCCACATGGG + Intronic
1049606696 8:143532904-143532926 GCGTCCTGGCCTGGTCACTCAGG - Intronic
1052989790 9:34512450-34512472 CAGGCCTGGCCAGGTCATTCAGG + Intronic
1053412639 9:37925532-37925554 TAGGCCTGGGCAGGGGACACTGG - Intronic
1053504667 9:38631396-38631418 GAGACCAGCCCAGGTAACACAGG - Intergenic
1055401646 9:75930372-75930394 GAGGCTGGGCCAGACCACACAGG + Intronic
1056112644 9:83410898-83410920 GAGGCCAGGCCAGCTCAGAAGGG + Intronic
1057314829 9:93961389-93961411 GAGGCCAGGCCAGATCACATTGG + Intergenic
1059059546 9:111020737-111020759 AAGGCAGGGGCAGGTCACACAGG - Intronic
1060552765 9:124493311-124493333 GAGGTCTGGCCAGTTAACAAAGG + Intronic
1060912282 9:127360736-127360758 GAGGCCTGCCCAGTTAACACTGG - Intronic
1061153941 9:128845867-128845889 TAGGCCTGACCAGGTCATTCAGG - Intronic
1061381440 9:130260987-130261009 GAGCCCTGTCCAGGGGACACTGG + Intergenic
1189137049 X:38561241-38561263 GAGGCCAGGCGAGGCGACACGGG - Intronic
1189350292 X:40270772-40270794 GAGGCCTGGCCTGGTCTTTCTGG - Intergenic
1189566251 X:42244328-42244350 GAGGAGTGGCAAGGTCAAACAGG + Intergenic
1190320415 X:49176495-49176517 GGGGCGTGGCCAGGGCACCCGGG + Intronic
1190828755 X:54042603-54042625 GAGGGCAGGCCAGGCTACACAGG - Intronic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1198107721 X:133477187-133477209 GTGGCCTGGCCAGGTCAAAGAGG + Intergenic
1200070954 X:153529113-153529135 AAGGGCTGGCCAGGTCACCTGGG - Intronic
1200103631 X:153700695-153700717 CAGGCCTGGCCAGGCCAAGCAGG + Exonic