ID: 1084112506

View in Genome Browser
Species Human (GRCh38)
Location 11:67023255-67023277
Sequence CCGGAGCTGCGCCGCAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084112506_1084112509 -10 Left 1084112506 11:67023255-67023277 CCCGGACTGCGGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1084112509 11:67023268-67023290 GCAGCTCCGGTCCGCCGCCCCGG 0: 1
1: 0
2: 1
3: 12
4: 113
1084112506_1084112525 26 Left 1084112506 11:67023255-67023277 CCCGGACTGCGGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1084112525 11:67023304-67023326 CCGGCCCGCGCCGCGCTCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 236
1084112506_1084112515 7 Left 1084112506 11:67023255-67023277 CCCGGACTGCGGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1084112515 11:67023285-67023307 CCCCGGCCCGGCCGAGCCCCCGG 0: 1
1: 0
2: 5
3: 115
4: 635
1084112506_1084112510 -5 Left 1084112506 11:67023255-67023277 CCCGGACTGCGGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1084112510 11:67023273-67023295 TCCGGTCCGCCGCCCCGGCCCGG 0: 1
1: 0
2: 2
3: 115
4: 5268
1084112506_1084112526 29 Left 1084112506 11:67023255-67023277 CCCGGACTGCGGCGCAGCTCCGG 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1084112526 11:67023307-67023329 GCCCGCGCCGCGCTCCTCGGAGG 0: 1
1: 0
2: 3
3: 23
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084112506 Original CRISPR CCGGAGCTGCGCCGCAGTCC GGG (reversed) Intronic
901041746 1:6368347-6368369 CGGTGGCTGCACCGCAGTCCAGG + Intronic
901057532 1:6455597-6455619 GCGGGGGTGCGCCGCCGTCCAGG - Intronic
905648300 1:39639747-39639769 CCGGAGCTGCGGCGCAGGAAAGG - Exonic
906719871 1:47997089-47997111 CCGGAGCTGCGTCGCGGTCCAGG + Intergenic
912685182 1:111756294-111756316 CCTGAGCTGCGGCGCGGGCCTGG - Intronic
914194686 1:145439653-145439675 CAGGAGCTGGTCAGCAGTCCAGG + Intergenic
914475960 1:148022218-148022240 CAGGAGCTGGTCAGCAGTCCAGG + Intergenic
924470746 1:244340569-244340591 TTGGAGCTGCGCTTCAGTCCCGG - Intergenic
1067688379 10:48481584-48481606 CCAGAGCTGTGCCCCTGTCCTGG + Intronic
1067734545 10:48839070-48839092 CAGGAGCTGAGCAGCACTCCAGG + Intronic
1067853283 10:49768886-49768908 CCGGATCCGCGCGGCAGTCCTGG + Intergenic
1069541205 10:69295249-69295271 CCGGAGCTGCGGCAGAGGCCTGG - Intronic
1073546498 10:104353830-104353852 CAGGAGCTGGGCCGGAGTCTGGG - Exonic
1075393845 10:122113057-122113079 CCGGCCCTGCGCCGTTGTCCCGG + Intronic
1076648530 10:131971138-131971160 CCCGGGCCGCGCCGCACTCCCGG + Intronic
1076818619 10:132926982-132927004 CCGGGGCTGCGCTGAAGTCTGGG + Intronic
1077360987 11:2139980-2140002 CCGGTGCCGCGCCGGAGCCCCGG + Intronic
1084112506 11:67023255-67023277 CCGGAGCTGCGCCGCAGTCCGGG - Intronic
1084464150 11:69312573-69312595 CCGGAGCTGTGCACCAGGCCTGG - Intronic
1089734610 11:120541086-120541108 CGGTAGCTGCGCCTCAGTCCAGG - Intronic
1091581592 12:1793729-1793751 CCGAGGCGCCGCCGCAGTCCTGG + Exonic
1091688997 12:2583147-2583169 CCGCAGCGGCGCCGCGCTCCGGG + Intronic
1096139936 12:49234550-49234572 CCCGCGTGGCGCCGCAGTCCTGG + Intronic
1103698525 12:122835578-122835600 CGGGTGCTGAGCCGCAGGCCGGG + Exonic
1104424815 12:128667435-128667457 CTGGAGCTGGGCTGCAATCCAGG - Intronic
1105250411 13:18694136-18694158 GCTGAGCTGAGCTGCAGTCCTGG + Intergenic
1110318396 13:74134945-74134967 CGCGAGCTGCCCCACAGTCCCGG - Intergenic
1112711772 13:102137890-102137912 CAGGAGGTGGGCCTCAGTCCAGG + Intronic
1114516129 14:23301465-23301487 CCGGAGCTCCGCCACTGCCCGGG + Exonic
1117072680 14:52069954-52069976 CCTGAGCTGCTCCGCAGGACTGG + Intergenic
1118024070 14:61751179-61751201 CGGGCGCAGCACCGCAGTCCCGG + Intergenic
1120765178 14:88322327-88322349 CTGGAGCTGCGCCGCATGCCCGG - Intronic
1124852931 15:33358556-33358578 CCACAGCTGCACCACAGTCCTGG - Intronic
1127606165 15:60591233-60591255 CCCGAGCTGCTTCGCAGGCCCGG - Intronic
1127988453 15:64093676-64093698 CGGGAGCTGCCCGGCAGCCCCGG - Exonic
1130224159 15:82045252-82045274 CCGGAGCCGCGCCGCTGCCCTGG - Intronic
1130517151 15:84634103-84634125 CCGCTGCAGCGCCGCCGTCCAGG + Intergenic
1133325046 16:4937141-4937163 CCACTGCCGCGCCGCAGTCCGGG - Intronic
1135547679 16:23376960-23376982 CCTGAGCTGGGCCCCAGGCCAGG + Intronic
1136478500 16:30527154-30527176 CCGGAGCTGACCCGGAGGCCCGG - Intronic
1136993319 16:35170360-35170382 GCGGAGCGGCGCGGCAGGCCGGG - Intergenic
1137758022 16:50918111-50918133 CCGCAGCTGCTCAGCAGCCCCGG + Intergenic
1139465235 16:67150729-67150751 CCGGCCCTGGGTCGCAGTCCTGG - Intronic
1140222922 16:73057646-73057668 TCGGGGCTGCGCCGCTGGCCAGG - Intronic
1140521971 16:75589507-75589529 CCGGAGCTGAGCCCAAGTACAGG + Intergenic
1143897209 17:10145596-10145618 CCGGATCTGTGCCCCAATCCTGG + Intronic
1145031529 17:19507986-19508008 CCGCTGCGGCGCCGCAGTTCAGG + Intronic
1147139310 17:38452490-38452512 CTGGAGCTGCCCCGCTTTCCTGG + Intronic
1148769107 17:50056707-50056729 CCGGAGCTGAGTCGGAGCCCAGG + Intronic
1149994411 17:61399372-61399394 CCGGAGCTGGGTCGGAGGCCAGG + Intergenic
1150236997 17:63601200-63601222 CCGGAGCGGCACCGCAGCCCCGG - Exonic
1152225146 17:79089444-79089466 CCGGGGCTCGGCTGCAGTCCTGG + Intronic
1154438435 18:14364790-14364812 GCTGAGCTGAGCTGCAGTCCTGG - Intergenic
1154501738 18:15000883-15000905 TCTGAGCTGCGCAGCAGGCCCGG + Intergenic
1156171715 18:34493912-34493934 GAGGCGCCGCGCCGCAGTCCTGG - Intronic
1156499645 18:37549415-37549437 CAGGGGCTGCCCCGCAGGCCAGG + Intronic
1158213906 18:55079591-55079613 CCGGAGCTCCTGCACAGTCCAGG + Intergenic
1160567758 18:79797904-79797926 GCGGGGCGGCGCCGGAGTCCGGG + Intergenic
1160930324 19:1567176-1567198 GGGGAGCCGCGCCGCAGCCCAGG - Intronic
1160960828 19:1720089-1720111 CCAGAGCTGAGCCTCTGTCCTGG + Intergenic
1161069261 19:2252305-2252327 CCGGCCCCGCGCCGGAGTCCAGG - Exonic
1161241421 19:3225557-3225579 CCGGACCTGCCCCGCCGGCCTGG - Intronic
1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG + Exonic
1163714301 19:18865182-18865204 CCGGAGCTGCACATCTGTCCTGG - Intronic
1165266588 19:34666814-34666836 CCTGGGCTGCGCTGCAGCCCTGG + Intronic
1167048486 19:47065436-47065458 CCGGGGCTGGGCTGCAGTGCAGG + Exonic
1167873975 19:52396466-52396488 CTGGAGCAGTGCCGTAGTCCAGG + Intergenic
1168343820 19:55641075-55641097 CCGGAGCTGCCCGGAAGTCTCGG + Intronic
1168721813 19:58558514-58558536 GCGGAGCGGCGCGGCAGGCCGGG - Exonic
928118826 2:28566977-28566999 GCGGAGCTGGGCGGCAGTCTCGG - Intronic
930177412 2:48314861-48314883 CGGGAGCTGCGCCGCGGGCTGGG - Intronic
932288135 2:70553828-70553850 GCGGAGCGGCGCCGCGGTGCGGG + Exonic
934746137 2:96760927-96760949 CCGGAGCTGCGGTGCGGACCGGG + Exonic
934966945 2:98731354-98731376 CCGGAGCGGAGCCGCGGTCTCGG + Intergenic
937044079 2:118841889-118841911 GGGGAGCTGCCCCGCAGCCCAGG + Intergenic
944172976 2:196799736-196799758 CTGCAGCTGCGGCGCAGACCGGG - Intergenic
944517447 2:200526385-200526407 CCGGAGAGGGGCCGCCGTCCCGG - Intronic
948492253 2:238320908-238320930 CCGGGGCTGGGCCGGAGTCGGGG + Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1173322258 20:41998695-41998717 CCTGCGCGGCGCCGCAGCCCTGG + Intergenic
1176457240 21:6924682-6924704 GCTGAGCTGAGCTGCAGTCCTGG + Intergenic
1176835413 21:13789766-13789788 GCTGAGCTGAGCTGCAGTCCTGG + Intergenic
1180002883 21:45003014-45003036 CCGGACCTGGGGCGCTGTCCTGG - Intergenic
1181531829 22:23521565-23521587 CCGGAGCTCAGGCGCAGTCCAGG - Intergenic
1182771905 22:32802163-32802185 CCTAAGCAGCGCTGCAGTCCTGG - Intronic
950040322 3:9915808-9915830 GCAGAGCTCCACCGCAGTCCCGG + Exonic
950043323 3:9933795-9933817 CCCCACCCGCGCCGCAGTCCAGG - Intergenic
950168028 3:10816215-10816237 CCGGCTCTGCGCCGCCGCCCCGG - Exonic
954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG + Exonic
954385087 3:50239878-50239900 CAGGGGCTGCTCCGCAGCCCTGG + Intronic
961666543 3:128496508-128496530 GCGGGGCTGCGCCGCTGTCCGGG + Intergenic
962195676 3:133361295-133361317 GCAGAGCTGAGCCACAGTCCAGG - Intronic
964570797 3:158105853-158105875 CCGCAGCAGCCCGGCAGTCCGGG - Exonic
968534378 4:1113894-1113916 CGGGAGCTGGGCCGGAGGCCAGG + Intergenic
968701712 4:2060656-2060678 AGGGAGCTGCCCCGCAGACCAGG - Intronic
968965239 4:3766211-3766233 CCTGAGCGGCCCCGCGGTCCCGG - Intergenic
990165445 5:52989142-52989164 CCGGGGCTGGGCCGCTGTACGGG + Intergenic
990581821 5:57173569-57173591 CCGGGGCTGCCTCGGAGTCCGGG - Intergenic
992502990 5:77359742-77359764 CCTTAGCTGAGCCTCAGTCCTGG + Intronic
996308638 5:122078221-122078243 GGGGAGCGGCGCGGCAGTCCCGG + Exonic
1001565438 5:172696698-172696720 CAGGAGCAGCCCCGCATTCCAGG + Intergenic
1001577095 5:172771460-172771482 CCGGACCCGCGCCGCGCTCCAGG + Intergenic
1002376889 5:178795335-178795357 CCGGAGCAGCACAGCATTCCTGG + Intergenic
1002526145 5:179817080-179817102 CCGGAGCCGCGCCGGGGGCCGGG + Intronic
1003032965 6:2618789-2618811 CTGGAGCTGCTCAGCTGTCCTGG - Intergenic
1005303828 6:24495236-24495258 CCAGAGCGGCGCCGCTGGCCGGG - Exonic
1005968692 6:30744424-30744446 CCGGAGCCCCGCCGGGGTCCCGG + Exonic
1006419193 6:33922959-33922981 CCGGAGTGGAGGCGCAGTCCTGG + Intergenic
1007230522 6:40344842-40344864 CCCCAGCTGGCCCGCAGTCCTGG + Intergenic
1009011995 6:57853987-57854009 GCGGCGCTGCGTCGCTGTCCAGG + Intergenic
1013455977 6:110330080-110330102 CAGGAGCAGCCCCGCAGTTCAGG + Intronic
1017324749 6:153131539-153131561 CCGGAGCTTCGCGGGAGGCCCGG + Intergenic
1017760303 6:157563096-157563118 CCGGAGCTGGGCTGGACTCCTGG + Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019399778 7:845937-845959 CCGGTGCTGCGTGGCTGTCCCGG + Intronic
1019612855 7:1945747-1945769 GCGGCGCTGGGCCGCAGACCGGG + Intronic
1023583419 7:41705224-41705246 CCGGAGCTTCCCCGCACCCCAGG + Intergenic
1025852238 7:65252787-65252809 TTTGAGCTGCGCGGCAGTCCTGG + Intergenic
1026665289 7:72336269-72336291 TCGGAGCCGCACCGCAGCCCAGG - Intronic
1029640580 7:101816871-101816893 CCGGAGCGGCGGCGCGGCCCGGG - Intronic
1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG + Exonic
1049177865 8:141205581-141205603 CCGGTGCTGCGCCCCTTTCCTGG - Intergenic
1049557271 8:143289355-143289377 CCTGGGCTGTGACGCAGTCCAGG + Intergenic
1061248679 9:129414239-129414261 CCGGAGCTCAGGCCCAGTCCGGG + Intergenic
1185746983 X:2581523-2581545 CCAGATCTGCGCCACTGTCCTGG - Intergenic
1187226133 X:17376401-17376423 CCGGAGCGGCGCCGCGGGGCTGG - Intronic
1192237137 X:69303157-69303179 CTGGATCTGCACAGCAGTCCTGG + Intergenic
1199793435 X:151175563-151175585 AAGGAGCTGCGCCGCAGCCGCGG - Intergenic