ID: 1084113062

View in Genome Browser
Species Human (GRCh38)
Location 11:67025784-67025806
Sequence CTCCCTCTCCTCCTCCGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 480}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084113056_1084113062 8 Left 1084113056 11:67025753-67025775 CCTCGGGCCAATTCACTGCCCTT 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1084113062 11:67025784-67025806 CTCCCTCTCCTCCTCCGTGGAGG 0: 1
1: 0
2: 3
3: 51
4: 480
1084113058_1084113062 -10 Left 1084113058 11:67025771-67025793 CCCTTCTCTGAGCCTCCCTCTCC 0: 2
1: 1
2: 20
3: 231
4: 1446
Right 1084113062 11:67025784-67025806 CTCCCTCTCCTCCTCCGTGGAGG 0: 1
1: 0
2: 3
3: 51
4: 480
1084113052_1084113062 28 Left 1084113052 11:67025733-67025755 CCTCCTCACTGGTTGGGTGACCT 0: 1
1: 0
2: 4
3: 33
4: 173
Right 1084113062 11:67025784-67025806 CTCCCTCTCCTCCTCCGTGGAGG 0: 1
1: 0
2: 3
3: 51
4: 480
1084113053_1084113062 25 Left 1084113053 11:67025736-67025758 CCTCACTGGTTGGGTGACCTCGG 0: 1
1: 0
2: 0
3: 28
4: 198
Right 1084113062 11:67025784-67025806 CTCCCTCTCCTCCTCCGTGGAGG 0: 1
1: 0
2: 3
3: 51
4: 480
1084113057_1084113062 1 Left 1084113057 11:67025760-67025782 CCAATTCACTGCCCTTCTCTGAG 0: 1
1: 0
2: 4
3: 31
4: 382
Right 1084113062 11:67025784-67025806 CTCCCTCTCCTCCTCCGTGGAGG 0: 1
1: 0
2: 3
3: 51
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084113062 Original CRISPR CTCCCTCTCCTCCTCCGTGG AGG Intronic