ID: 1084113640

View in Genome Browser
Species Human (GRCh38)
Location 11:67029206-67029228
Sequence CTCAGTCATTCCTAAAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084113637_1084113640 -2 Left 1084113637 11:67029185-67029207 CCTTTCTAGAACAACTTAAGCCT 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 177
1084113635_1084113640 4 Left 1084113635 11:67029179-67029201 CCCAGACCTTTCTAGAACAACTT 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 177
1084113636_1084113640 3 Left 1084113636 11:67029180-67029202 CCAGACCTTTCTAGAACAACTTA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084113640 Original CRISPR CTCAGTCATTCCTAAAAGCT GGG Intronic
900011547 1:114978-115000 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900027650 1:291542-291564 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900041607 1:470984-471006 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900063042 1:705961-705983 TTCAGAAATTCCTATAAGCTTGG + Intergenic
910192303 1:84606495-84606517 CTCAGCCTTTCCAAAAAGGTAGG - Intergenic
911125291 1:94335642-94335664 CACAGTCATTCCTCAAGGCAGGG + Intergenic
911739160 1:101368515-101368537 CCCAGTCATTCCAAAAATCAAGG - Intergenic
912094553 1:106121792-106121814 CACAGTCATGCCTGAAAGCCTGG - Intergenic
916934755 1:169616089-169616111 AGCAGACATTCCTGAAAGCTTGG - Intronic
917253961 1:173094622-173094644 CTTATTCATTCCTAAACGATTGG + Intergenic
917586432 1:176431931-176431953 CTCAGTCATGCCTCTAAGATAGG - Intergenic
920113898 1:203606335-203606357 CTGAGTAATTTCTACAAGCTAGG - Intergenic
922259986 1:223930986-223931008 TTCAGAAATTCCTATAAGCTTGG + Intergenic
922482989 1:225951910-225951932 CTGAGACATTCCCTAAAGCTTGG - Intergenic
924341150 1:243033545-243033567 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1065053998 10:21824888-21824910 CTCAGGCATTCCGAGTAGCTGGG + Intronic
1066735319 10:38471862-38471884 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1067880872 10:50043753-50043775 CCCAGCCAGTACTAAAAGCTGGG + Intergenic
1070109438 10:73469423-73469445 CTCAGCCCTCCCTAATAGCTGGG - Intronic
1070738162 10:78879169-78879191 GACAGTCATTCCTAAAAGATGGG + Intergenic
1074796922 10:116956040-116956062 TTCTGACATTCCTAAAAGATGGG - Intronic
1074879846 10:117647354-117647376 ACCATTCATTCCTGAAAGCTCGG - Intergenic
1076102015 10:127790035-127790057 CTTAGCCATTTCTATAAGCTAGG + Intergenic
1076967882 11:107212-107234 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1080782402 11:35442069-35442091 CTCCTTCATTCTTTAAAGCTTGG + Intronic
1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG + Intronic
1084166429 11:67376814-67376836 CTGTGACATTCCTAAAAGCAGGG - Intronic
1084526145 11:69699257-69699279 CTCAGTTACTTCTCAAAGCTGGG + Exonic
1085040698 11:73324688-73324710 CTCAGGCAGTCCTGAAAGCCAGG - Intronic
1088500817 11:110480526-110480548 CAGAGTCATTCCTAGAAGCAAGG + Intergenic
1094066414 12:26365259-26365281 CTTAGTGATTCCTGAAACCTGGG + Intronic
1095569243 12:43664270-43664292 AAAAGTCATTCCCAAAAGCTAGG - Intergenic
1099347323 12:81518418-81518440 TTCAGTAATTCTTCAAAGCTAGG + Intronic
1099449644 12:82793664-82793686 CTAAGTCATTTCTAACAGCACGG - Intronic
1103622116 12:122193548-122193570 TTCAATCATTCCGAAAATCTTGG - Intronic
1104927934 12:132323307-132323329 CTGGGTCGTTCCTAGAAGCTCGG + Intronic
1107724165 13:43280983-43281005 CTCTGACATTCCTAAAATGTTGG - Intronic
1108994598 13:56712115-56712137 TTTAATCTTTCCTAAAAGCTAGG + Intergenic
1111620786 13:90722797-90722819 CTCACTCATTCCCAAAAGGTGGG - Intergenic
1112655708 13:101450784-101450806 CTCTGTGATTCCTTAGAGCTGGG + Intergenic
1113279061 13:108768781-108768803 CTCAGCCATTCCAAACAGCTTGG + Intronic
1115604464 14:34986544-34986566 CTCAGTCATTACTAAAAAATTGG + Intronic
1118091151 14:62480879-62480901 CTCAGTGATGGCTAAAAGCTAGG - Intergenic
1119374788 14:74181188-74181210 CTCTGTCCTTCCAAAATGCTGGG - Intronic
1119992718 14:79217373-79217395 CTCACTCATTACTAAGAGCAGGG + Intronic
1121804793 14:96808314-96808336 GTCAGTCATTCCTGAAGACTTGG + Intronic
1122737297 14:103850121-103850143 TTCAGTTATTCCTAATTGCTTGG - Intergenic
1129652338 15:77499944-77499966 CTCAGCCCTCCCTAATAGCTGGG + Intergenic
1131976108 15:97947314-97947336 CTCTGTGGTTCCTAAAAGATTGG + Intergenic
1134141520 16:11723828-11723850 TTCATTTATTCCTAACAGCTTGG - Intronic
1135751772 16:25064135-25064157 CACAGTCACTCCTATCAGCTGGG - Intergenic
1136241219 16:28945489-28945511 CTCAAGCATTCCTAGTAGCTGGG + Intergenic
1139278022 16:65746057-65746079 CTAAGTCATTCCCAAGAGCTTGG + Intergenic
1140222773 16:73056243-73056265 CACAGTCAGTCTTGAAAGCTTGG - Intronic
1141072275 16:80968533-80968555 CTAACTCATTCCTAGAAGATGGG - Exonic
1142333913 16:89474381-89474403 CTCAGTCATTCCTTCCACCTTGG - Intronic
1142452798 16:90191927-90191949 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1142808075 17:2382035-2382057 TGCACTCTTTCCTAAAAGCTGGG - Intergenic
1145915251 17:28570156-28570178 CTTATTCATTCCTAAATTCTTGG + Intronic
1149403647 17:56324862-56324884 CTCAGTGACTCATAAAACCTGGG - Intronic
1149414570 17:56446067-56446089 CTCATTCTTTCCAAAAACCTTGG + Intronic
1150221060 17:63496204-63496226 CTCAGACAATGCTAAGAGCTGGG + Intronic
1151513683 17:74578664-74578686 ATCATTCATTCCAAAATGCTGGG - Intergenic
1151855311 17:76717101-76717123 CTCAGTCTTTCTTAAATGCATGG - Intronic
1152994089 18:390203-390225 CTCAGGTGTTCCTAAAACCTGGG + Intronic
1156758306 18:40555605-40555627 CACAGTCATTCCTTAATGGTAGG - Intergenic
1157175219 18:45445608-45445630 TTCAATCATTCCTATGAGCTAGG - Intronic
1159024943 18:63175099-63175121 CTCAGTCACTCTCCAAAGCTTGG + Intronic
1160644687 19:176835-176857 TTCAGAAATTCCTATAAGCTTGG + Intergenic
925409259 2:3629779-3629801 CTCAGTGATTTTTAACAGCTGGG - Intronic
927092908 2:19726058-19726080 GTCAGATATTCCTAAAAGGTTGG - Intergenic
931601326 2:64006014-64006036 CTCAGTCATTTTAAAAAGGTGGG + Intronic
932084033 2:68741714-68741736 CTCAGTCACTACTAAAAAGTAGG - Intronic
933103963 2:78297629-78297651 GTCAGTTGTTCCTAAAAGCTTGG - Intergenic
933476744 2:82801228-82801250 CTCAGCCATTCATATTAGCTAGG - Intergenic
935590614 2:104843487-104843509 CTCAGTCATTACTAAGGGGTTGG + Intergenic
936470772 2:112796979-112797001 CTCCTTCATTCATAAAAGATGGG + Intergenic
940196313 2:151098346-151098368 CTCACTCAATCCTAAGAGGTGGG + Intergenic
941683061 2:168420019-168420041 CACAGTCATTCCTTTAAACTGGG - Intergenic
941843445 2:170111357-170111379 CTCTGTCAGTCCCAACAGCTGGG + Intergenic
943037267 2:182762731-182762753 CTCAGACATGCCAGAAAGCTGGG + Exonic
945024481 2:205606853-205606875 CACAGGGATTCCTTAAAGCTGGG + Intronic
947776558 2:232716493-232716515 CTCAGTCATCCCTACTAGCTGGG + Intronic
949084239 2:242136588-242136610 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1169466105 20:5840689-5840711 AGAAGTAATTCCTAAAAGCTAGG + Intronic
1169829998 20:9814482-9814504 CTCAGTGATTCCTAAAATAATGG - Intronic
1172657674 20:36546924-36546946 CTCAGTCCTTCCACGAAGCTGGG - Intronic
1174275254 20:49398947-49398969 CTCAGTCAATCACAAAGGCTGGG - Intronic
1174343720 20:49914768-49914790 CTCGGTCATTCCTACAGCCTCGG + Intronic
1174588977 20:51630200-51630222 CGCCGTCATTCCTCAGAGCTAGG - Intronic
1176280822 20:64309072-64309094 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1178891332 21:36523242-36523264 ATCAGTCCTTTCTAAAACCTGGG - Intronic
1178981776 21:37270369-37270391 CTAAGTCACTCTTCAAAGCTTGG + Intergenic
1181323586 22:22026975-22026997 CTCAGTGATGCCAAACAGCTAGG + Intergenic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
1183614735 22:38937077-38937099 CTCTGTCATTCCCAGAAGCAGGG + Intergenic
1184745148 22:46451751-46451773 CATAGTAATTCCTAAAATCTGGG + Intronic
949303731 3:2615794-2615816 ATAGGTCATTCCTAAAGGCTAGG - Intronic
949451846 3:4194323-4194345 CCCAGTCATTGCCAGAAGCTTGG - Intronic
950369907 3:12520408-12520430 GTCAGACATTTCTAAAAGCGTGG - Intronic
951482690 3:23178592-23178614 CCCAGACATTCTTAATAGCTGGG - Intergenic
953152160 3:40334352-40334374 AAAAGTGATTCCTAAAAGCTTGG - Intergenic
953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG + Intronic
956011701 3:64838615-64838637 CACAGTGCTTCTTAAAAGCTAGG + Intergenic
956990389 3:74756220-74756242 CTCAATCATTCTAAAATGCTGGG - Intergenic
957798073 3:85037717-85037739 CAGAGTCTTTCCTAAAAACTTGG + Intronic
959967066 3:112368204-112368226 CTCAATCATTCATCAAAGCATGG + Intergenic
960130798 3:114054261-114054283 CTCTGTAACTCCTAGAAGCTTGG + Intronic
963329104 3:143894413-143894435 CTCAGACATTCCTAGCTGCTTGG - Intergenic
963847098 3:150170654-150170676 GTCAGTCATTCCAAAAGGCAAGG - Intergenic
967209866 3:187158911-187158933 TTCAGGCATTCCTAGAAGGTAGG - Intronic
968335092 3:197906809-197906831 CTGACTCAGTCCTAAGAGCTAGG + Intronic
968599939 4:1504021-1504043 CTCAGCCAATCCTCAGAGCTGGG + Intergenic
969408777 4:7014077-7014099 CTCACTCTTTCCTAAAAACCAGG - Intronic
969883923 4:10198414-10198436 CAAATTCATTCCTAGAAGCTAGG - Intergenic
970881707 4:20939885-20939907 TTCAGACATTGCTAAAAGCTTGG - Intronic
971381817 4:26106066-26106088 CTCTGTCATTCCAAAGAGGTGGG + Intergenic
974158860 4:58110820-58110842 CTCTGGATTTCCTAAAAGCTAGG - Intergenic
974278534 4:59759437-59759459 CTCAGGCATTCCTGAACACTTGG - Intergenic
974411309 4:61544430-61544452 ATCAGTAGTTCTTAAAAGCTAGG - Intronic
977985518 4:103378189-103378211 CTCAGTGAATCCTAAACACTTGG - Intergenic
978128712 4:105167899-105167921 TTCCTTCATTCCTTAAAGCTAGG - Intronic
978428025 4:108602793-108602815 CTTAGTCATTCTTTAAAGGTAGG + Intergenic
978878891 4:113676300-113676322 CGCAGTCATTCCTTGAAACTTGG + Intronic
979261674 4:118654826-118654848 TTCAGAAATTCCTATAAGCTTGG - Intergenic
979805632 4:124967138-124967160 CTCGGACATTCCGAAAAACTAGG - Intergenic
980297918 4:130946352-130946374 CACTGTCATTCCATAAAGCTTGG - Intergenic
981813143 4:148798551-148798573 CACAGGCTCTCCTAAAAGCTGGG - Intergenic
981854107 4:149266892-149266914 GGCAGTCATTCCTAATAGATTGG + Intergenic
983150157 4:164268501-164268523 TTCAGAAATTCCTATAAGCTTGG + Intronic
987639194 5:20589716-20589738 CCCACTCATTTCTAGAAGCTGGG - Intergenic
987748129 5:22004387-22004409 CTCAGTCAAACCTAAATCCTTGG + Intronic
988710287 5:33767253-33767275 CACAGTCATTCCTGAATGGTTGG + Intronic
993703260 5:91143156-91143178 CACAGTCATGCCCAGAAGCTTGG + Intronic
995540976 5:113186060-113186082 CTCAGTCAGTCCCACAAACTAGG - Intronic
995630879 5:114130867-114130889 AGCAGTCATTCAAAAAAGCTCGG + Intergenic
995775132 5:115716963-115716985 ATAAGCCATTCCTAAACGCTTGG - Intergenic
996066096 5:119080948-119080970 CTAACTCATCCCTAAAGGCTTGG + Intronic
996798351 5:127375575-127375597 GTCATTCACTCATAAAAGCTAGG - Intronic
997782583 5:136675161-136675183 CTCACTCATTCCTTAAACTTGGG - Intergenic
998182649 5:139956186-139956208 GACAGTGATTCCTACAAGCTAGG - Intronic
999190679 5:149744851-149744873 CTTAGTGATTCATAAGAGCTTGG + Intronic
999864549 5:155686347-155686369 TTCAGTCATTCTTAAGAGATAGG - Intergenic
1000559239 5:162765457-162765479 ATAAGTCATTCCTCATAGCTAGG - Intergenic
1002732237 5:181347945-181347967 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1002752299 6:126160-126182 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1009297423 6:61970531-61970553 CTCAGTAATCTCTAAATGCTAGG - Intronic
1015136397 6:129877084-129877106 CTCAGTAAGTCTTAAAAGCATGG + Intergenic
1016555074 6:145327311-145327333 CTCATTCAGTCCTCAAAGCCAGG - Intergenic
1017307734 6:152938948-152938970 CTCAGGCATTAATAAAAGCCAGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018849680 6:167578019-167578041 CTCACTCATTCCTGAGAGTTCGG + Intergenic
1019196985 6:170288852-170288874 AGCAGTCATTCCTAACAGCCAGG + Intronic
1019236489 6:170620260-170620282 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1020067646 7:5201179-5201201 TTCAGTCATTCGTAAAAGCCTGG - Intronic
1022031506 7:26495476-26495498 CTCACCTATTCCTAAAAGCGGGG + Intergenic
1022211451 7:28214165-28214187 CTCAGTGATCCCTGAAGGCTTGG - Intergenic
1024195784 7:47057590-47057612 CTCAGCCTTTCCGAATAGCTGGG - Intergenic
1024532971 7:50408532-50408554 CCCAATCATTCCGAAAAGCTGGG - Intergenic
1024987506 7:55208314-55208336 ATCAGTCAGTACTCAAAGCTTGG + Exonic
1030416871 7:109255971-109255993 CTCAGTCTTTCCTACCACCTAGG + Intergenic
1031586853 7:123541003-123541025 CCCTGTCATTCCTAAATACTTGG - Exonic
1031894128 7:127328629-127328651 CTCTGGCATTCCTAAAAACATGG - Intergenic
1032024471 7:128430634-128430656 CTGAGTCTTTCCCAAAAGCTGGG - Intergenic
1032799167 7:135304593-135304615 CTCAGTCATTCCTCTAGGATGGG - Intergenic
1035511281 8:186348-186370 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1036205911 8:6805669-6805691 CTGAGTCATTCAGAAAAGCCTGG + Intergenic
1038635497 8:29283476-29283498 CACATTCATTGCTAAAAACTGGG + Intergenic
1042108985 8:65358992-65359014 CTCAGTCATTCCTGTCACCTTGG + Intergenic
1045789628 8:105967459-105967481 TTCAGTTCTTTCTAAAAGCTTGG + Intergenic
1051871571 9:21743945-21743967 CTCATTTGTTCTTAAAAGCTAGG - Intergenic
1052307692 9:27029630-27029652 CTCAGCCTTTCCGAATAGCTGGG - Intronic
1052987883 9:34501526-34501548 GTAAGCCATTCCAAAAAGCTTGG + Intronic
1057573456 9:96220867-96220889 CTCAGCCCCTCCTAGAAGCTGGG - Intergenic
1058999519 9:110334131-110334153 CCCAGTAATTCTTAAAAGTTTGG - Intronic
1059488433 9:114645623-114645645 CTCAGTCAGTCCTAGAACCCCGG + Intronic
1059785830 9:117582969-117582991 TTCAGTCATTCCTCACAGCATGG - Intergenic
1062756639 9:138300271-138300293 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1186380895 X:9057771-9057793 TTCTGTCATTCCTTAAATCTGGG - Intronic
1186589405 X:10914115-10914137 CAAAGTCATTGCTTAAAGCTAGG - Intergenic
1188850202 X:35122896-35122918 CACAGTCACTACTAGAAGCTGGG + Intergenic
1191688988 X:63920831-63920853 CTCAGAAATTCCCAGAAGCTAGG - Intergenic
1192338371 X:70240472-70240494 CACAGTCATTCCTCAAAGGAGGG + Exonic
1197230084 X:123994286-123994308 CTCACTCATTACCAAAAGATTGG + Intronic
1198801978 X:140457450-140457472 CTCAGTCATTTGTTAAATCTAGG + Intergenic
1198806812 X:140502004-140502026 CTCAGCCTTTCCAATAAGCTTGG - Intergenic
1199023936 X:142915940-142915962 CTCAGTCATTCAGTAAAACTTGG - Intergenic
1201351834 Y:13052486-13052508 TTCAGTAATCCCTAAAAGTTCGG - Intergenic
1202383761 Y:24303290-24303312 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1202487022 Y:25366830-25366852 TTCAGAAATTCCTATAAGCTTGG + Intergenic