ID: 1084115642

View in Genome Browser
Species Human (GRCh38)
Location 11:67041573-67041595
Sequence CTGGAAGGGCGTAACAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084115633_1084115642 -2 Left 1084115633 11:67041552-67041574 CCTCAGGGATGGCATGGTACCCT 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1084115642 11:67041573-67041595 CTGGAAGGGCGTAACAGGAGGGG 0: 1
1: 0
2: 1
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084115642 Original CRISPR CTGGAAGGGCGTAACAGGAG GGG Intronic
900178057 1:1299357-1299379 CTGGAGGGCCGGAGCAGGAGGGG + Intronic
902386777 1:16080443-16080465 CTGGGAGGGTGAAACAGGACAGG - Intergenic
902608027 1:17580093-17580115 CCGGAAGGGACTGACAGGAGTGG + Intronic
903188012 1:21640182-21640204 CGGGAAGGGGGTAACAGGCAGGG - Intronic
904492111 1:30867693-30867715 CTGGGAGGTCCTCACAGGAGTGG - Intergenic
906659010 1:47569225-47569247 CAGGAAGGGCATAGCTGGAGGGG - Intergenic
907316405 1:53575447-53575469 CAGGAAGGGTGTCCCAGGAGAGG - Intronic
908109974 1:60887141-60887163 CTGGAAGGATGCAACAGGAGCGG + Intronic
910152224 1:84163499-84163521 CTGGAAGGGGCTGACATGAGAGG - Intronic
914221963 1:145689407-145689429 CTGCAATGGGGCAACAGGAGGGG - Intronic
914338262 1:146736705-146736727 AGGGAATGGGGTAACAGGAGAGG - Intergenic
917729848 1:177863878-177863900 CTGGAAGGGCTGTACAGGAAGGG - Intergenic
918201610 1:182272544-182272566 CTGGAAGGAGGCAAGAGGAGAGG + Intergenic
920546867 1:206825634-206825656 CTGGAAGGGCTTCACTGAAGGGG + Intronic
922575022 1:226655530-226655552 CTGGAAAGGCCTGGCAGGAGCGG + Intronic
1063381427 10:5588593-5588615 CAGACAGGGAGTAACAGGAGAGG - Intergenic
1065186568 10:23174757-23174779 CTGAAAGGGCCTGAAAGGAGCGG + Intergenic
1069425944 10:68288751-68288773 CTCAAAGAGCTTAACAGGAGGGG + Intronic
1070886859 10:79908086-79908108 TTGGAAGGGCGTAGCAGGCCTGG + Intergenic
1071606271 10:86993782-86993804 TTGGAAGGGCGTAGCAGGCCTGG + Intergenic
1073193125 10:101666444-101666466 GTGGAAGGGAGTAGGAGGAGGGG + Intronic
1075095620 10:119468914-119468936 CTGGAAGGGAGTAAGAGAGGAGG + Intergenic
1077999578 11:7482877-7482899 CAGGAAGGGGGAAGCAGGAGAGG + Intergenic
1080766550 11:35302697-35302719 ATGGAAGGGACCAACAGGAGTGG - Intronic
1084115642 11:67041573-67041595 CTGGAAGGGCGTAACAGGAGGGG + Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1090981395 11:131725619-131725641 CTGGAGGGGAGTAAGAGGAAGGG + Intronic
1091815235 12:3432605-3432627 CTGGAAAGCAGCAACAGGAGAGG + Intronic
1094421269 12:30273601-30273623 TTGGAACTGGGTAACAGGAGAGG - Intergenic
1107357879 13:39587398-39587420 CTGGCAAGGCGTCACAGCAGAGG - Intronic
1107414876 13:40191178-40191200 CTGGAAGGTTATAAAAGGAGTGG + Intergenic
1112593647 13:100788007-100788029 CTGAAAGGGCAAAACATGAGGGG - Intergenic
1123804895 15:23860661-23860683 CTGGGAGGGGGGATCAGGAGGGG + Intergenic
1125223290 15:37365794-37365816 TTGGAAGGCAGGAACAGGAGAGG - Intergenic
1127811977 15:62572869-62572891 CAGGAAGAGCGCAGCAGGAGGGG - Intronic
1128768244 15:70264142-70264164 CTGGAAGCGGGTAGCAGGAGTGG - Intergenic
1129117588 15:73373793-73373815 CTGGAAGGGTGGAAGGGGAGGGG + Intergenic
1129636693 15:77326164-77326186 GGGGAAGGGAGTAGCAGGAGGGG - Intronic
1133081223 16:3321784-3321806 CTGGAGGGGAAGAACAGGAGGGG + Intergenic
1133729543 16:8567944-8567966 CCGGAAAGGCGCAAAAGGAGTGG - Intergenic
1133933571 16:10251588-10251610 CTGGAAGGGGGTGACACGTGGGG - Intergenic
1134572352 16:15302019-15302041 CTGGAAAGGCATCACTGGAGTGG - Intergenic
1134730029 16:16454030-16454052 CTGGAAAGGCATCACTGGAGTGG + Intergenic
1134937403 16:18257871-18257893 CTGGAAAGGCATCACTGGAGTGG - Intergenic
1137592962 16:49704991-49705013 CTGGAAGGGCTAGGCAGGAGTGG - Intronic
1139351927 16:66342432-66342454 CTGGATGGGTGGGACAGGAGTGG + Intergenic
1142204809 16:88777910-88777932 CAGGAGGGGCGTCAAAGGAGGGG - Intronic
1152762816 17:82118262-82118284 CTGGGAGGGAGTAAGAGAAGAGG + Intronic
1156408667 18:36807104-36807126 CTGGAGGGGAGGAACTGGAGGGG + Intronic
1157164112 18:45342359-45342381 CTGGAAGGCAGGAACAGCAGGGG + Intronic
1159396635 18:67866362-67866384 CTGGAATGGAGTAATCGGAGAGG - Intergenic
1163594261 19:18211704-18211726 CTGGGAGGAAGTAAAAGGAGGGG - Intronic
1164556525 19:29256861-29256883 CTGCCAGGGCTTTACAGGAGAGG + Intergenic
1165475155 19:36026266-36026288 CTGGAAGTGGGCAAGAGGAGGGG + Intronic
1168104876 19:54160568-54160590 ATGGAAGAGCGTGTCAGGAGTGG - Intronic
1168567118 19:57434516-57434538 CTGGAAAGGCGCAACTGGAAGGG - Intronic
926688816 2:15718622-15718644 CAGGATGGGCCTAGCAGGAGGGG - Intronic
927488035 2:23502617-23502639 CTGGAAGGGCCAAACACGAGGGG - Intronic
928269001 2:29838087-29838109 CTGGATGGGCTTAACAACAGAGG + Intronic
930960224 2:57252182-57252204 TTGGAAGTGGGTAACAGCAGAGG - Intergenic
932419276 2:71592090-71592112 CCGGAAGGGCGTGAGAGGTGAGG + Intronic
933152266 2:78929973-78929995 CTGGAAGGGGGAAAGAGGAAGGG + Intergenic
933157172 2:78989313-78989335 TAGGAAGGGAATAACAGGAGAGG - Intergenic
933809794 2:86026140-86026162 CTGGAAGGAGGTCACAGCAGAGG + Exonic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
939618349 2:144386511-144386533 AGAGAAGGGGGTAACAGGAGGGG + Intergenic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
946112633 2:217433583-217433605 CTGGAAGGGGAGAAAAGGAGGGG - Intronic
946142959 2:217706966-217706988 CTGGAGGGGAGAAACAGGATGGG - Intronic
946980768 2:225212854-225212876 CTTGAAGAGCTTAATAGGAGAGG + Intergenic
947807041 2:232976218-232976240 GTGGAAGGGAGCAACAGAAGAGG - Intronic
948756852 2:240165117-240165139 CTGGAAGGGCGGGACAGTGGTGG + Intergenic
1169869551 20:10236390-10236412 CTGGCAGGGTGGAGCAGGAGGGG + Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172835220 20:37869118-37869140 ATGGATGGGCCTAACAGAAGAGG + Intronic
1173994614 20:47328141-47328163 CTTAAAGGGTGTAACAGGACAGG + Intronic
1176222105 20:63974604-63974626 CTGGGAGGGTGTAAGGGGAGTGG + Exonic
1176704489 21:10102007-10102029 TTGGAACTGCGTAACAGGCGGGG - Intergenic
1181727355 22:24820650-24820672 ATGGAAGGGTGTGGCAGGAGTGG + Intronic
1182524601 22:30907455-30907477 CTGGAAGGGGGCATGAGGAGAGG - Exonic
1183268566 22:36846595-36846617 CAGGAGGGGAGAAACAGGAGAGG - Intergenic
1183629551 22:39025018-39025040 CTGGGACGGGGGAACAGGAGGGG - Intronic
1184594695 22:45506697-45506719 CTGGAAGTGGGTAGAAGGAGGGG - Intronic
1184741570 22:46431618-46431640 CTGGAAGGGCACAACAGGAAGGG + Intronic
1185261714 22:49869285-49869307 CTGGAAGGGCCTAAAGGCAGAGG + Intronic
949918449 3:8983387-8983409 GTGGAAGGGAGCATCAGGAGAGG - Exonic
950043891 3:9937694-9937716 CTGGAAGTGGGTCACAGGTGAGG + Intronic
950756654 3:15178790-15178812 CTGTAAGGGAGTAACAGAAGTGG - Intergenic
952909605 3:38171122-38171144 CTGGAAGGACGTGACAGGTGTGG - Intronic
953160655 3:40416263-40416285 CTGGAAGTGGGCAACATGAGAGG - Intronic
954624595 3:52015692-52015714 CTGGAAGAGCTGAGCAGGAGGGG + Intergenic
955231001 3:57098590-57098612 CGGGAAGTGAGTAACAGGAAGGG + Intronic
956080917 3:65555209-65555231 CTGGAAGGGCCTAGCATGGGTGG - Intronic
968699626 4:2048353-2048375 CAGGAAGGGCGTCCCAGCAGAGG - Intergenic
976694493 4:87904491-87904513 ATGGAAGGGCCTAGCAGGAGAGG + Intergenic
977704620 4:100057488-100057510 CTGGAAAGGCTTCACAGTAGGGG + Intergenic
978779342 4:112533686-112533708 ATGGAAGGGAGTAACTGGTGGGG - Intergenic
984039555 4:174714051-174714073 GTGGAAGGTAGAAACAGGAGAGG - Intronic
984736617 4:183114557-183114579 CTGGAAGAGAGGAAAAGGAGAGG + Intronic
985652312 5:1112642-1112664 ATGGCAGGGGGGAACAGGAGGGG - Intergenic
985723582 5:1503608-1503630 CTGGGAGGAAGTGACAGGAGCGG - Intronic
997475816 5:134141835-134141857 CTGGAAGGGTCAAGCAGGAGAGG + Intronic
1004675990 6:17842637-17842659 GTGGGAGGGCCTAACTGGAGAGG + Intronic
1006750247 6:36372535-36372557 CTGGAATGGGGCAGCAGGAGAGG + Intronic
1011058062 6:83228436-83228458 TTGGAAGGGAGTAAAGGGAGGGG - Intronic
1012804243 6:103875201-103875223 CTGGAAGGGGGTCCCAAGAGTGG - Intergenic
1013596632 6:111666439-111666461 CTAGAAGGGCAGAACAGCAGAGG - Intronic
1019979896 7:4613782-4613804 CTGGAAGGGAGTAGGAGGAGGGG - Intergenic
1022559247 7:31332372-31332394 CTGGAAGGGGCTGGCAGGAGGGG + Intergenic
1022832161 7:34078962-34078984 CTGGAAGGGCGAGGCAGGGGAGG - Exonic
1024527355 7:50360149-50360171 CTGGAAGGGAGGGACAGCAGAGG + Intronic
1035449669 7:158968565-158968587 CAGAAAGTGCGTAAGAGGAGAGG + Intergenic
1036061523 8:5327260-5327282 CTGGAAGGGAGTCAAAGGAAAGG + Intergenic
1040581490 8:48702175-48702197 CTGGAAGGGCTTCACTGGGGAGG + Intergenic
1041673789 8:60517511-60517533 CAGGAAGTGTGTGACAGGAGGGG + Intronic
1044428265 8:92079757-92079779 CTGGAAGGGCGTGGTTGGAGTGG - Intronic
1046790594 8:118317621-118317643 CTGGAAGGGTGCAACAAGAAAGG + Intronic
1049614176 8:143569065-143569087 CTGGGAGGGAGAAACTGGAGGGG + Intronic
1049720149 8:144111897-144111919 CTGGAAGGGGGTCCCAGCAGTGG + Exonic
1050038661 9:1464183-1464205 TTGGAAGGAAGTAACAGGAGTGG + Intergenic
1050274968 9:3987193-3987215 CTGGAAGGGCTCAACAGTAGAGG + Intronic
1052109635 9:24564879-24564901 TTGGAAGCGAGGAACAGGAGAGG + Intergenic
1052740081 9:32384566-32384588 CGGGAAGGGCGGAGCAGGGGCGG - Intergenic
1054755363 9:68952025-68952047 CTGGAAGGGTGTAGGAGGAGGGG - Intronic
1056595060 9:88001212-88001234 TTGGAACTGGGTAACAGGAGAGG + Intergenic
1057144483 9:92748987-92749009 GGGCAAGGGGGTAACAGGAGAGG + Intronic
1060872958 9:127057348-127057370 GTGGAAGGGAGTTACAGGTGTGG + Intronic
1062123607 9:134847821-134847843 CAGGAAGGGCTTTGCAGGAGAGG + Intergenic
1062359528 9:136180965-136180987 CTGGAAGGGCATACCAGGAGGGG + Intergenic
1202789524 9_KI270719v1_random:72099-72121 TTGGAACTGCGTAACAGGCGGGG - Intergenic
1187025588 X:15432761-15432783 CTGGAAGGGAGTAAGAATAGAGG + Intronic
1188983869 X:36752423-36752445 CTGGTAGGACGTAGTAGGAGGGG + Intergenic
1194149902 X:90310748-90310770 TTGGAACTGGGTAACAGGAGAGG - Intergenic
1196063053 X:111431873-111431895 CTGGAAAGGGGGAATAGGAGGGG + Intergenic
1199325349 X:146492552-146492574 TTGGAACTGGGTAACAGGAGAGG + Intergenic
1200496328 Y:3887823-3887845 TTGGAACTGGGTAACAGGAGAGG - Intergenic