ID: 1084116483

View in Genome Browser
Species Human (GRCh38)
Location 11:67045651-67045673
Sequence TTGGGGAGTTTGGAGTCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084116476_1084116483 18 Left 1084116476 11:67045610-67045632 CCAATGGCAGGGCTGCAGGAGGT 0: 1
1: 0
2: 2
3: 31
4: 303
Right 1084116483 11:67045651-67045673 TTGGGGAGTTTGGAGTCGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084116483 Original CRISPR TTGGGGAGTTTGGAGTCGGT GGG Intronic
900375285 1:2351426-2351448 TCTGGGACTTTCGAGTCGGTTGG + Intronic
902120577 1:14161767-14161789 TTGGGGGGTTTGGAGATGGAAGG - Intergenic
904751801 1:32745315-32745337 TTTGGGAGTTTGAGGTGGGTGGG + Intronic
906287127 1:44594750-44594772 TTGGGGAATTTGGATTGGATTGG + Intronic
910676838 1:89822974-89822996 TTGGGGTGTTTGGTCTCTGTAGG + Intronic
912566744 1:110592842-110592864 TTTGGGTGTTTGGAGTAGGGGGG + Intergenic
916075917 1:161199958-161199980 TAGGGCAGTTGGGAGTGGGTAGG - Intronic
920266344 1:204726335-204726357 TTGGGAGGGTTGGAGTCGGGGGG - Intergenic
923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG + Intergenic
1064511983 10:16104813-16104835 TTAGGCAGTTTGGAGTCGAATGG + Intergenic
1066282551 10:33931827-33931849 CTGGGGAATTTGGAGAGGGTGGG + Intergenic
1070394002 10:75996007-75996029 TTGGTGAGTTTGGAGAGGTTAGG - Intronic
1070417182 10:76201871-76201893 ATTGGCAGTTTGGACTCGGTTGG + Intronic
1070627241 10:78060126-78060148 TTGGGGAGAGTGGATTGGGTAGG - Intergenic
1070647153 10:78209980-78210002 TTAAGGAGTTTAGAGTCTGTTGG + Intergenic
1073441424 10:103555101-103555123 GTGGGGAGGCTGGAGTGGGTGGG + Intronic
1075779268 10:125006305-125006327 GTGGGGGGTTGGGAGTGGGTGGG + Intronic
1076016228 10:127029415-127029437 TTGGAAAGTTTGGTGTCGATGGG + Intronic
1078614174 11:12849369-12849391 TTGCGGAGTTTAGAGATGGTGGG - Intronic
1080695782 11:34601909-34601931 TTGGGGAGTTTGGGGTCAGCTGG - Intergenic
1083722464 11:64610173-64610195 CAGGGGAGATTGGAGTCGGGTGG - Intronic
1084116483 11:67045651-67045673 TTGGGGAGTTTGGAGTCGGTGGG + Intronic
1084912341 11:72400931-72400953 TTGGGGAGTTTGCAGTCTAATGG - Intronic
1085562248 11:77482846-77482868 TTTGGGAGTCTGAAGTCGGGAGG - Intergenic
1089013407 11:115148015-115148037 TGGGGGGGTGTGGAGTCTGTGGG + Intergenic
1089172041 11:116518885-116518907 TTGGGGAGTTTGGGTTGGTTTGG - Intergenic
1089309149 11:117546512-117546534 GTGGGCAGTTAGGAGTTGGTGGG - Intronic
1091435837 12:472228-472250 TTGCTGAGTTTGGACTTGGTAGG + Intronic
1091585549 12:1814241-1814263 ATGGGGAGTCTGGAGAGGGTGGG + Intronic
1091615673 12:2049777-2049799 TTGGGGATTTGGGAGGTGGTGGG - Intronic
1091885414 12:4013611-4013633 TTGGGGAGTTGGGGGTGGGGTGG + Intergenic
1097261851 12:57724990-57725012 GTGGGCAGGTTGGAGTCAGTGGG - Intronic
1098454969 12:70661791-70661813 TTGGGAAGTTTGGAATAGGAAGG - Intronic
1101705968 12:107221605-107221627 TTGGGGATTTGGGAGGCGGGCGG + Intergenic
1102298682 12:111756133-111756155 CTGGGGAGTCTGGAGGCCGTGGG + Intronic
1102687533 12:114736184-114736206 GTGGGGAGTTGGGAGTGGGTTGG + Intergenic
1103773306 12:123346234-123346256 TTGGGGAGATTGGGGTGGGAGGG - Intronic
1106223795 13:27770135-27770157 TTGGGGACTTTGGACTTGTTGGG + Intergenic
1107472055 13:40700112-40700134 TTGGGGGGTTGGGAGGTGGTTGG - Intergenic
1108427045 13:50313097-50313119 TTGGGGAGTGTGGGGTTGGATGG - Intronic
1109221752 13:59647124-59647146 TTGGGGAGTCTGGAGTACGGTGG - Intergenic
1112380351 13:98882989-98883011 TAAGTGAGTTTGGAGTAGGTTGG - Intronic
1113818350 13:113191857-113191879 TTGCGTAGTTTGGTGCCGGTGGG - Intronic
1114532859 14:23406210-23406232 ATGGGGAGTGTGGAGTAGATGGG - Intronic
1121788798 14:96683288-96683310 GTGTGGATTTTGGAGCCGGTTGG - Intergenic
1122774114 14:104109696-104109718 TTGGGGAGGTTGGGGCAGGTGGG + Intronic
1124679970 15:31722432-31722454 TGAGAGTGTTTGGAGTCGGTGGG - Intronic
1125613359 15:40988053-40988075 TTTGCGAGTTTGGCGTCAGTAGG + Intronic
1128417076 15:67456860-67456882 ATGGGGTGTTTGGAGTGGGTGGG - Intronic
1129169958 15:73801600-73801622 TTGGGGAGTATGGAAGTGGTGGG + Intergenic
1133318836 16:4900763-4900785 ATGGGAAGCTTGGAGTCGGGGGG - Intronic
1133966820 16:10537702-10537724 TTTGGGAGTTTGGATTGAGTTGG - Intronic
1136169634 16:28480932-28480954 TTGGTGACTTTGAAGTCAGTGGG - Intronic
1136655252 16:31705703-31705725 TTGGGTGGTGTGCAGTCGGTGGG - Intergenic
1138100719 16:54250090-54250112 TTGGGGATCTTGGCTTCGGTTGG + Intronic
1140621248 16:76735979-76736001 TTGGGCAGGTGGGAGTTGGTGGG - Intergenic
1142717400 17:1754670-1754692 TTGGGGAGTTTAGGGTGGGGGGG + Exonic
1143407911 17:6690344-6690366 GTGGGGACTTGGGAGTAGGTAGG - Intronic
1144626516 17:16846870-16846892 TTGGGGAGCCTGGAGTGGGGAGG - Intergenic
1144879916 17:18425841-18425863 TTGGGGAGCCTGGAGTGGGGAGG + Intergenic
1145152317 17:20518543-20518565 TTGGGGAGCCTGGAGTGGGGAGG - Intergenic
1146163662 17:30572746-30572768 TTGGGGAGCCTGGAGTGGGGAGG - Intergenic
1146886165 17:36472327-36472349 TTGGGGATTCTGGAGTTTGTGGG + Intergenic
1147580657 17:41625557-41625579 TTGGGGAGCCTGGAGTGGGAAGG - Intergenic
1148088103 17:45006740-45006762 TTGGGGGGGTTGGAGGGGGTTGG - Intergenic
1148088119 17:45006769-45006791 TGGGGGGGTTTGGAGGGGGTTGG - Intergenic
1149673683 17:58439014-58439036 TTGGGGGGTTGGGGGTAGGTTGG + Intronic
1150631851 17:66885422-66885444 TGTGGGAGTCTGGAGTCTGTGGG + Exonic
1153609432 18:6868383-6868405 ATGGGGTGTTTGGAGTTGGGTGG - Intronic
1156361312 18:36386841-36386863 TTGGGGGGATTGGAGAAGGTGGG + Intronic
1156474720 18:37398242-37398264 TTCTGGAGTTTGGAGTCAGAAGG + Intronic
1157115043 18:44854578-44854600 TTGGGAAGATTGGAGTGGGTAGG - Intronic
1160000386 18:75014061-75014083 TTGGGCAGTTTGGGGTAGCTTGG + Intronic
1162850817 19:13429965-13429987 GTGGGGAGTGTGGAGTAGGGTGG + Intronic
1163767614 19:19172159-19172181 TTGGGGAGTGTGGAGGTGGCTGG + Intronic
1165113920 19:33517722-33517744 TTGGGGAGGCTGAAGTGGGTGGG + Intronic
1165615772 19:37199113-37199135 TTGGGGAGTTTGGTGTGTGTAGG - Intronic
1165904692 19:39186659-39186681 TTAGGGGGCTTGGAGTCGTTTGG + Intergenic
1167986546 19:53323468-53323490 TTGGAGAGTTTGTTGTTGGTGGG - Intergenic
1168644394 19:58050891-58050913 GTGGGGAGATTGGAGGCGGGAGG - Intronic
925108284 2:1311564-1311586 TTTGTGAGTTTGGCGTCAGTAGG + Intronic
925135361 2:1522708-1522730 TTGGGGAGGTTGCAGACAGTGGG - Intronic
925137217 2:1530174-1530196 TTGGGGAGGTTGGACACAGTGGG - Intronic
925139109 2:1537730-1537752 GTGGGGAGTTTGCAGACAGTTGG - Intronic
925923522 2:8654164-8654186 GTGGTGATTTTGGAGTAGGTGGG - Intergenic
927948251 2:27150219-27150241 TTGGAGAGCTTGGTGTCGGGCGG - Exonic
930235550 2:48885536-48885558 TTGGGAAGATTGGAGTGGGCTGG + Intergenic
931539538 2:63314695-63314717 TTGAGGAGATTGGAGACAGTGGG - Intronic
931602750 2:64019748-64019770 TAGGGATGTTTCGAGTCGGTTGG - Intergenic
934532845 2:95106366-95106388 TTGGAGAGGTTGGGGTGGGTGGG - Intronic
935101818 2:100003093-100003115 CTGGGGAGTTGGGGGTCGGGGGG + Intronic
937350036 2:121154879-121154901 TAGGGGAGCTTGGAGGCTGTTGG + Intergenic
940806923 2:158198056-158198078 TTGAAGTGTTTGGAGTAGGTTGG - Intronic
1173984444 20:47250263-47250285 TTGGGGGCACTGGAGTCGGTGGG - Intronic
1182166081 22:28174876-28174898 TTGGAGTGTTTGGGGTCTGTTGG + Intronic
1184072129 22:42152867-42152889 TTGGGGAGGTGCGAGTCTGTGGG - Intergenic
1184455345 22:44606911-44606933 GTGGTGAGCTTGGAGGCGGTAGG - Intergenic
1185035151 22:48471443-48471465 CTGGGGATTTTGGTGTCTGTGGG - Intergenic
1185380226 22:50504523-50504545 TTGGGGGGTGTGGAGTGGGCTGG - Intronic
949523171 3:4875897-4875919 TTGGGGGGCTTGGAGTGGGGAGG - Intronic
950006485 3:9694826-9694848 CGGGGGAGTTGGGAGCCGGTAGG + Intronic
950580565 3:13859255-13859277 TGGAGGAGGTTGGAGACGGTGGG - Intronic
950911705 3:16602112-16602134 TTGGGGAGTTGGGGGTGGGGAGG + Intronic
953360845 3:42294936-42294958 TTGGGGTGTTTGGATTTAGTAGG + Intergenic
954640745 3:52096350-52096372 TTGGGGATTTTGGAGTCTAGTGG + Intronic
954952972 3:54491239-54491261 TTAGGGAGTTTGCAGCCAGTTGG + Intronic
959002688 3:100982748-100982770 TAGGGGAGTTTGGAGAGGATGGG + Intronic
960157932 3:114317043-114317065 ATGGGGAGTTTGGTGTCAGTTGG - Intergenic
960548952 3:118951683-118951705 TTGGGGATTTTGGTGTCTGGGGG - Intronic
962579782 3:136787815-136787837 TTGGGCAGTTTTGAATCTGTGGG + Intergenic
962940213 3:140118654-140118676 TTGGGGAGTTTGCATTGGATAGG + Intronic
965802365 3:172507769-172507791 TTTGGGGGTTTGGGGTTGGTTGG - Intronic
967734921 3:192941948-192941970 TATGGGAGTTTGGAGTTGGAGGG + Intergenic
969278712 4:6154723-6154745 GTGGGGAGTTAGGAGTGGGCTGG - Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970179473 4:13375053-13375075 CTGGGCAGTTTGGAGTGGGAAGG - Intronic
970536024 4:17030503-17030525 TTGGGGAGAGTGGATTCTGTAGG + Intergenic
970572780 4:17399020-17399042 TTGGAGAGTTTGGAGACAGAGGG + Intergenic
972786009 4:42327401-42327423 CTGTGGAGTTTAGAGTCTGTGGG - Intergenic
980593262 4:134919994-134920016 TTGGGGAGTATGGAGTTGCAAGG - Intergenic
983940077 4:173528880-173528902 TTGGAGAGTTTGGTGTCGGCGGG + Exonic
985832241 5:2242349-2242371 CTGTGGAGCTTGGGGTCGGTGGG + Intergenic
986551066 5:8956302-8956324 TTGGGGAGTATGTATTAGGTTGG - Intergenic
986624095 5:9707267-9707289 CTGGGGAGTTGGGAGTCTGCAGG - Intronic
988599113 5:32623024-32623046 TTGGGGAGTTTTGAGTTGTTTGG + Intergenic
988776862 5:34485014-34485036 TTGGGGAGGTTGGAGAGGTTGGG - Intergenic
993872415 5:93268114-93268136 TGGGGGAGTGTGTAGTTGGTGGG - Intergenic
999731153 5:154477614-154477636 TTGGAGAGCTTGGTGTCGGCCGG + Exonic
1002696070 5:181092010-181092032 TTTGGGAGGTTGAAGTGGGTGGG - Intergenic
1002774065 6:314025-314047 ATGATGTGTTTGGAGTCGGTGGG + Intronic
1003870732 6:10400650-10400672 TTAGGGAGTTGGGAGTGGGGAGG - Intronic
1006907562 6:37543279-37543301 TTTGGGAGTTGGGAGGCGGGTGG + Intergenic
1007589807 6:43014259-43014281 TTGGGGACTAAGGCGTCGGTTGG + Exonic
1008513765 6:52300462-52300484 TGGGGCAGTTTGGAGGCTGTGGG - Intergenic
1011535575 6:88372408-88372430 TTGGGGAGTTGAGAGTAGGAAGG + Intergenic
1014672132 6:124318341-124318363 TTGGGGAGTTTTATGTCTGTTGG + Intronic
1015496617 6:133889725-133889747 TTGGAGAGCTTGGTGTCGGGGGG - Exonic
1017871169 6:158487934-158487956 TTGTGGAGTTTGCAGTAGTTGGG + Intronic
1020234719 7:6346893-6346915 TTGGGGAGTTTACAGTTGGACGG - Intronic
1024270246 7:47636316-47636338 TTGGGGAATGTGGACTCTGTGGG - Intergenic
1024550075 7:50555268-50555290 TTGTGTGGTTTGGAGTCAGTGGG + Intronic
1029001513 7:97159827-97159849 TTCGGGAGTTTCGAGAAGGTTGG + Intronic
1029494114 7:100888072-100888094 CTGGGGAGTCTGGTGTGGGTAGG - Exonic
1032462953 7:132125567-132125589 TTTGGGATTTTGGAGTTGTTTGG - Exonic
1037468957 8:19188434-19188456 TTGGGGATGTTGGAGGTGGTGGG + Intergenic
1037469217 8:19191041-19191063 TTGGGGATGTTGGAGATGGTGGG - Intergenic
1037695321 8:21218349-21218371 CTGAGGAGTTTGGAGTCTGGTGG - Intergenic
1038981165 8:32761073-32761095 TTGGGGAGATTGGGTTGGGTTGG + Intronic
1041006624 8:53502487-53502509 CTGGGGAGTGTGGAGTCCCTTGG + Intergenic
1045724718 8:105159171-105159193 TTGAGGAGTTTGAACTCAGTAGG + Intronic
1047202957 8:122781837-122781859 GTGGGGAGTGGGGAGTGGGTGGG + Exonic
1053008308 9:34618957-34618979 TTGGGGAGTTTCAAGTCTGATGG + Intronic
1057839793 9:98477093-98477115 TTGGGGAGTTTTGGGAGGGTGGG + Intronic
1059742590 9:117166786-117166808 TAGGGGAGTTTGCAGTCTATGGG - Intronic
1060864821 9:126987337-126987359 TTGGGGAGTTGGGGGGCAGTTGG + Intronic
1186009654 X:5115327-5115349 TTGTGGAATTTGGAATGGGTTGG + Intergenic
1186789101 X:12979806-12979828 TTGGGGAGTGTGGAGTGCGGAGG - Intergenic
1188745027 X:33830753-33830775 CTTGGGAGTTAGGAGTGGGTTGG + Intergenic
1189383964 X:40521597-40521619 TTGGGGAGTTGGGAGGTGGGAGG + Intergenic
1189400057 X:40659167-40659189 TTGAGGAGGTTAGAGTTGGTGGG - Intronic
1190109910 X:47582961-47582983 TTGAGGAATTTGGAGGAGGTTGG - Intronic
1190180537 X:48187762-48187784 TTGGGTAGATTGGAGAGGGTTGG + Intronic
1190844305 X:54177188-54177210 CTGAGAAGTTTGGACTCGGTAGG + Intronic
1196226378 X:113172205-113172227 TTGGGGATTTTGGTGGGGGTGGG - Intergenic
1196794448 X:119490950-119490972 GTGGGGAGTTTGGGGGTGGTGGG - Intergenic
1197971391 X:132118857-132118879 TTGGGGAGTTGGGGGGCTGTGGG - Intronic