ID: 1084118187

View in Genome Browser
Species Human (GRCh38)
Location 11:67054017-67054039
Sequence GAGCGACCACATGAGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084118176_1084118187 22 Left 1084118176 11:67053972-67053994 CCCCAAGCAGGGAGGCAGCCCCA No data
Right 1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG No data
1084118177_1084118187 21 Left 1084118177 11:67053973-67053995 CCCAAGCAGGGAGGCAGCCCCAG No data
Right 1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG No data
1084118181_1084118187 4 Left 1084118181 11:67053990-67054012 CCCCAGGTGATGACTGTGCAGGG No data
Right 1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG No data
1084118178_1084118187 20 Left 1084118178 11:67053974-67053996 CCAAGCAGGGAGGCAGCCCCAGG No data
Right 1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG No data
1084118183_1084118187 3 Left 1084118183 11:67053991-67054013 CCCAGGTGATGACTGTGCAGGGA No data
Right 1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG No data
1084118175_1084118187 29 Left 1084118175 11:67053965-67053987 CCAGGAACCCCAAGCAGGGAGGC No data
Right 1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG No data
1084118184_1084118187 2 Left 1084118184 11:67053992-67054014 CCAGGTGATGACTGTGCAGGGAG No data
Right 1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084118187 Original CRISPR GAGCGACCACATGAGGGCAG TGG Intergenic
No off target data available for this crispr