ID: 1084118543

View in Genome Browser
Species Human (GRCh38)
Location 11:67055949-67055971
Sequence AGCCTCACCCTCTGCGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084118538_1084118543 -9 Left 1084118538 11:67055935-67055957 CCACTGTGCAAGCGAGCCTCACC No data
Right 1084118543 11:67055949-67055971 AGCCTCACCCTCTGCGGGGGCGG No data
1084118535_1084118543 23 Left 1084118535 11:67055903-67055925 CCACTGAGCAAGCACCAGCTCCT No data
Right 1084118543 11:67055949-67055971 AGCCTCACCCTCTGCGGGGGCGG No data
1084118537_1084118543 3 Left 1084118537 11:67055923-67055945 CCTCATGCTGCACCACTGTGCAA No data
Right 1084118543 11:67055949-67055971 AGCCTCACCCTCTGCGGGGGCGG No data
1084118536_1084118543 9 Left 1084118536 11:67055917-67055939 CCAGCTCCTCATGCTGCACCACT No data
Right 1084118543 11:67055949-67055971 AGCCTCACCCTCTGCGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084118543 Original CRISPR AGCCTCACCCTCTGCGGGGG CGG Intergenic
No off target data available for this crispr