ID: 1084118584

View in Genome Browser
Species Human (GRCh38)
Location 11:67056143-67056165
Sequence CGGGAGTAGGGACAGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084118584_1084118593 30 Left 1084118584 11:67056143-67056165 CCCGCTGCCTGTCCCTACTCCCG No data
Right 1084118593 11:67056196-67056218 TGTCTACCATTCTAAGCCGTGGG No data
1084118584_1084118592 29 Left 1084118584 11:67056143-67056165 CCCGCTGCCTGTCCCTACTCCCG No data
Right 1084118592 11:67056195-67056217 GTGTCTACCATTCTAAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084118584 Original CRISPR CGGGAGTAGGGACAGGCAGC GGG (reversed) Intergenic
No off target data available for this crispr