ID: 1084118592

View in Genome Browser
Species Human (GRCh38)
Location 11:67056195-67056217
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084118585_1084118592 28 Left 1084118585 11:67056144-67056166 CCGCTGCCTGTCCCTACTCCCGT No data
Right 1084118592 11:67056195-67056217 GTGTCTACCATTCTAAGCCGTGG No data
1084118586_1084118592 22 Left 1084118586 11:67056150-67056172 CCTGTCCCTACTCCCGTTGTAGT No data
Right 1084118592 11:67056195-67056217 GTGTCTACCATTCTAAGCCGTGG No data
1084118590_1084118592 9 Left 1084118590 11:67056163-67056185 CCGTTGTAGTTCTGATCACACTG No data
Right 1084118592 11:67056195-67056217 GTGTCTACCATTCTAAGCCGTGG No data
1084118589_1084118592 10 Left 1084118589 11:67056162-67056184 CCCGTTGTAGTTCTGATCACACT No data
Right 1084118592 11:67056195-67056217 GTGTCTACCATTCTAAGCCGTGG No data
1084118588_1084118592 16 Left 1084118588 11:67056156-67056178 CCTACTCCCGTTGTAGTTCTGAT No data
Right 1084118592 11:67056195-67056217 GTGTCTACCATTCTAAGCCGTGG No data
1084118584_1084118592 29 Left 1084118584 11:67056143-67056165 CCCGCTGCCTGTCCCTACTCCCG No data
Right 1084118592 11:67056195-67056217 GTGTCTACCATTCTAAGCCGTGG No data
1084118587_1084118592 17 Left 1084118587 11:67056155-67056177 CCCTACTCCCGTTGTAGTTCTGA No data
Right 1084118592 11:67056195-67056217 GTGTCTACCATTCTAAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084118592 Original CRISPR GTGTCTACCATTCTAAGCCG TGG Intergenic