ID: 1084118716

View in Genome Browser
Species Human (GRCh38)
Location 11:67056721-67056743
Sequence GGCTGGGGCCCTTCCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 371}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084118716_1084118724 1 Left 1084118716 11:67056721-67056743 CCTGGAGAGGAAGGGCCCCAGCC 0: 1
1: 0
2: 0
3: 55
4: 371
Right 1084118724 11:67056745-67056767 AGCCGCCCGGGCCTCTCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 164
1084118716_1084118729 9 Left 1084118716 11:67056721-67056743 CCTGGAGAGGAAGGGCCCCAGCC 0: 1
1: 0
2: 0
3: 55
4: 371
Right 1084118729 11:67056753-67056775 GGGCCTCTCACCTGGCTCTCGGG 0: 2
1: 1
2: 3
3: 30
4: 288
1084118716_1084118728 8 Left 1084118716 11:67056721-67056743 CCTGGAGAGGAAGGGCCCCAGCC 0: 1
1: 0
2: 0
3: 55
4: 371
Right 1084118728 11:67056752-67056774 CGGGCCTCTCACCTGGCTCTCGG 0: 1
1: 0
2: 3
3: 28
4: 299
1084118716_1084118730 10 Left 1084118716 11:67056721-67056743 CCTGGAGAGGAAGGGCCCCAGCC 0: 1
1: 0
2: 0
3: 55
4: 371
Right 1084118730 11:67056754-67056776 GGCCTCTCACCTGGCTCTCGGGG 0: 1
1: 0
2: 2
3: 13
4: 215
1084118716_1084118732 17 Left 1084118716 11:67056721-67056743 CCTGGAGAGGAAGGGCCCCAGCC 0: 1
1: 0
2: 0
3: 55
4: 371
Right 1084118732 11:67056761-67056783 CACCTGGCTCTCGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084118716 Original CRISPR GGCTGGGGCCCTTCCTCTCC AGG (reversed) Intergenic
900254877 1:1692855-1692877 TGCTCGGGCCCTTCCACTGCAGG + Intronic
900263625 1:1746130-1746152 TGCTCGGGCCCTTCCACTGCAGG + Intergenic
900272400 1:1798026-1798048 GGCTGGGCACCTTTCCCTCCAGG - Intronic
900562739 1:3315615-3315637 CGCTCAGGCCCCTCCTCTCCAGG - Intronic
900686147 1:3948949-3948971 GGCTGGGGACCTTCCTGTGGGGG - Intergenic
901003327 1:6159990-6160012 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003359 1:6160101-6160123 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003367 1:6160118-6160140 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003381 1:6160152-6160174 GGCTGGGGCTCTTCCCTTGCTGG - Intronic
901003388 1:6160169-6160191 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003418 1:6160260-6160282 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003430 1:6160297-6160319 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003444 1:6160331-6160353 GGCTGGGGCTCTTCCCTTGCTGG - Intronic
901003451 1:6160348-6160370 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003481 1:6160439-6160461 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003494 1:6160476-6160498 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901065605 1:6492807-6492829 GGGAGGGGCCATTTCTCTCCTGG + Intronic
901242203 1:7702079-7702101 GGCTGGGCTCGTTCTTCTCCTGG - Intronic
902561729 1:17281785-17281807 GGGTGGGGCCCCACCTGTCCAGG - Intronic
902648226 1:17819029-17819051 GGCAGGGGCCATTCTTCCCCTGG - Intronic
902777309 1:18682976-18682998 GGCTGGGGTCCCTGCTCACCAGG + Intronic
902979454 1:20112754-20112776 GGCTGAGGCCAGGCCTCTCCTGG - Exonic
903194349 1:21673654-21673676 GGCTGAGGGCCTGCCTCGCCTGG + Intergenic
903438193 1:23368273-23368295 GGCTGGGTCCCTCCCGCGCCGGG + Intronic
903807669 1:26017126-26017148 TGCTGGGTCCCTTCCTCTGAGGG + Intergenic
903974785 1:27142287-27142309 GCCTGGGGCCAATCCTCTCTGGG + Intronic
904651364 1:32008372-32008394 GGCTGGGGCCTTTTGTCTCCTGG + Intergenic
904744647 1:32703148-32703170 GGCTGCGGCCCTTCCCCTCTTGG - Intronic
904753246 1:32754104-32754126 CGCTGGGGGCCTTCCTCTTGTGG - Intronic
905264298 1:36740366-36740388 GTCAGGGGCTATTCCTCTCCTGG + Intergenic
905414461 1:37794658-37794680 AGCTGGGGCCCTACAGCTCCCGG + Exonic
905486396 1:38299909-38299931 GGCAGTGGCCCTACCTGTCCTGG - Intergenic
905540349 1:38755633-38755655 GGCTGGTGCCCTCCCTTCCCTGG + Intergenic
906062745 1:42958965-42958987 GCCTGGGGCCCAGCCTGTCCTGG + Intergenic
906284302 1:44576585-44576607 CACTGGGGCCCATCCTGTCCTGG - Intronic
906365405 1:45205929-45205951 GGCTGCGGCCCCTCCTCGGCCGG + Exonic
906548923 1:46645132-46645154 GGCTTGTGCCCTTCCTCTAGAGG - Intronic
907074392 1:51565229-51565251 GGGTGAGGCCCTTCCTGGCCTGG + Intergenic
907408049 1:54265794-54265816 GGCTGGGGCCTTTGCTCACACGG - Intronic
907987744 1:59549197-59549219 CTCTGGAGCCCTTCCTCTCCAGG + Intronic
911674811 1:100647187-100647209 TGCTGGGACCCTTCCTCATCAGG - Intergenic
914717502 1:150264793-150264815 GCCTGGGTCCATTCCTCTCTAGG - Exonic
914901265 1:151712389-151712411 GCCTGGGGTCCTGCCACTCCTGG + Intronic
915489379 1:156242853-156242875 GGCCAAGGCCCTGCCTCTCCGGG + Intronic
915603885 1:156938907-156938929 GGGTGGGGACCTTCCTCCCTGGG + Intronic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
918276729 1:182959999-182960021 ACCTGGGTCCCTTCTTCTCCAGG + Intergenic
920091336 1:203455269-203455291 GGCTGGGGCCCCTCCGCTCATGG - Intergenic
920867143 1:209762604-209762626 GGCTGGGGGCCTTCCTCCACAGG + Exonic
920954672 1:210607573-210607595 TACTGGGGGCCTCCCTCTCCAGG - Intronic
921924278 1:220698683-220698705 TGCTGGGGCCTTTCCTTGCCTGG + Exonic
922705903 1:227789859-227789881 GGCTGGGCCCCTGCTTCTCCTGG + Intergenic
922795926 1:228339828-228339850 GGCTGGGGCCCTGTGGCTCCTGG - Intronic
922798379 1:228352822-228352844 GGCTGGGGCCCTTCCCCTTGTGG + Intronic
922924419 1:229335852-229335874 GGCTGGGGGCCTCCGTATCCAGG + Intronic
923037301 1:230293278-230293300 GGAGGGGGCTCTTCATCTCCAGG - Intergenic
923544584 1:234914834-234914856 GGCTGGGGCTCTGCCTGGCCAGG + Intergenic
924030228 1:239878874-239878896 TGCTGGAGCCCTTCCTCCTCAGG - Intronic
1064589604 10:16875153-16875175 GGCCAGGCCCGTTCCTCTCCAGG + Intronic
1065259962 10:23914021-23914043 GGCTGGGTCCCTTTCTCCCAAGG - Intronic
1067440515 10:46306865-46306887 GCCAGGGGCACTTACTCTCCAGG - Exonic
1069837338 10:71317835-71317857 AGCTAAGCCCCTTCCTCTCCTGG + Intergenic
1070680839 10:78448031-78448053 GGCAGGGCCCCTTTCTTTCCAGG + Intergenic
1070921051 10:80186598-80186620 GGCTGAGGCCCTGCCTCTGCGGG - Intronic
1071482019 10:86071827-86071849 GGCTGGGGCAGTTCCTCTCATGG - Intronic
1071514899 10:86290934-86290956 CCCTGGGCCGCTTCCTCTCCAGG - Intronic
1072044798 10:91644004-91644026 GGGTGGGGCGCTGCCTCACCCGG + Intergenic
1072247390 10:93555455-93555477 GCGTGGGGTCCTTCCTTTCCTGG - Intergenic
1073321851 10:102620429-102620451 TGCTGGGGCCCTGACTCTCCTGG - Intronic
1073694460 10:105849519-105849541 GGGTGGGGCGCTGCCTCACCCGG + Intergenic
1074149963 10:110750349-110750371 GGGTGAGGACCTTCCTCTCAGGG + Intronic
1074777241 10:116775398-116775420 GGCTGGCCCCCGTCCTCCCCAGG - Intergenic
1075355224 10:121766334-121766356 GACAGGGGGCCTTCCACTCCAGG + Intronic
1075452186 10:122558942-122558964 GGCAGGGAGCCTTCCCCTCCAGG - Intergenic
1076341030 10:129744878-129744900 GCCTGGGGACCATCCTTTCCTGG - Intronic
1076438736 10:130464543-130464565 GGGTGGGGCCTTTCCTCTGGTGG + Intergenic
1076765623 10:132631372-132631394 GGGTGGGGGCTCTCCTCTCCAGG - Intronic
1076881557 10:133242004-133242026 GGCCAGGGCCCTTACTCACCGGG - Intergenic
1077017752 11:404425-404447 GGCCCGGACCCTTCCTCTCTGGG - Intronic
1077020934 11:416906-416928 GGCTGGGGCCCGAGCTCGCCCGG - Intronic
1077102082 11:826961-826983 GGGAGGGGCCCCTCCTGTCCGGG - Intronic
1077115736 11:883848-883870 GGGTGGGGCCCTGCCTCTGGTGG - Intronic
1077246694 11:1542692-1542714 GGCTGCAGCCCTCCCTCTACTGG - Intergenic
1077319304 11:1934074-1934096 GGCTGAGGCCTTCCTTCTCCCGG + Intronic
1077464239 11:2726040-2726062 GCCTGGGGCCCCTTCTCTGCCGG - Intronic
1079517794 11:21289374-21289396 GGGTGGGGCGGTTCCTCACCTGG + Intronic
1081084594 11:38784295-38784317 GGTTTGGACCCTTCCTTTCCAGG - Intergenic
1081935273 11:46899661-46899683 GGCTGAGGCCCAGTCTCTCCAGG - Intronic
1083141191 11:60723076-60723098 AGCTGGGCCCTTTCTTCTCCAGG - Intergenic
1083668283 11:64286790-64286812 GCCTGGGGCCCTTGCCCTTCTGG + Exonic
1083758047 11:64801921-64801943 GGCTGGGGCCCCTTTTCCCCAGG + Intronic
1083949167 11:65944613-65944635 GGCTGAGGCTCTCCCTCTCCGGG - Intergenic
1084040336 11:66539129-66539151 GGCTGGGGCTCTACCTCCCCTGG - Exonic
1084118716 11:67056721-67056743 GGCTGGGGCCCTTCCTCTCCAGG - Intergenic
1084483377 11:69434610-69434632 GTCTGGAGCCCTCCCTCCCCAGG - Intergenic
1084962439 11:72724303-72724325 GGCTGAGGCCGGTCATCTCCAGG - Intronic
1086268365 11:85028816-85028838 GGGTGGGGGCCTCCCCCTCCTGG - Intronic
1086671840 11:89557377-89557399 GGCTTGGGTCCCTCCTTTCCCGG - Intergenic
1087816272 11:102662475-102662497 GTCAGAGGCCCTTCCTCTTCTGG - Intergenic
1089599549 11:119605038-119605060 GGATAGGGCTCTGCCTCTCCTGG - Intergenic
1089671150 11:120057912-120057934 GGGTGATGCCCTCCCTCTCCTGG + Intergenic
1089789112 11:120929717-120929739 GCATGGGGCCCTTCCTCTTCTGG + Intronic
1089921797 11:122215907-122215929 GACTTGAGCCTTTCCTCTCCAGG - Intergenic
1090628029 11:128622765-128622787 GCCTGGAGCTCTTCCCCTCCTGG - Intergenic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1092480657 12:8856356-8856378 AGATGTGGCCCTTCCTCTTCAGG - Intronic
1092512431 12:9170947-9170969 GGGTGGGATCCTTCCTCACCTGG - Intronic
1094364845 12:29669299-29669321 GGCAGGGGCCCTTTCACTCCGGG + Intronic
1094541787 12:31368958-31368980 GGCTTGGTCTCTCCCTCTCCAGG + Intergenic
1096654288 12:53079097-53079119 GGCTGGGGCCCGGCTGCTCCCGG - Intronic
1096693454 12:53334874-53334896 GACTGGGCCACTTCCCCTCCGGG - Intronic
1096995994 12:55838585-55838607 GGGTGAGGCCCCTCCCCTCCAGG - Exonic
1097147876 12:56954122-56954144 CTCTGGGGCTCTTCCTCTCTAGG - Intronic
1097154979 12:57006140-57006162 GGCTGGGGCGCTCCCTCTGGAGG + Intronic
1097981374 12:65741158-65741180 GGAAGGCGACCTTCCTCTCCAGG + Intergenic
1098891356 12:76013016-76013038 GGCTGCAGCCCCTCCTGTCCTGG - Intergenic
1099690826 12:85949137-85949159 CACTGCTGCCCTTCCTCTCCGGG + Intergenic
1100329711 12:93571791-93571813 GGCAGACGCCCCTCCTCTCCCGG + Exonic
1101035750 12:100704143-100704165 AGCTGGGCATCTTCCTCTCCTGG + Intergenic
1101460297 12:104884296-104884318 GGGTGGGGCACTGCCTCACCAGG - Intronic
1101948167 12:109154171-109154193 TGCTGGGGTCCTCCCTGTCCTGG + Intronic
1102385274 12:112503836-112503858 TGCTGGGTTCCTTACTCTCCTGG + Intronic
1102523635 12:113495025-113495047 GGCTGGAGCCCTTGTTCTCATGG + Intergenic
1103169235 12:118799430-118799452 GGGTGGGGCATTTCCTCACCTGG - Intergenic
1103724463 12:122990851-122990873 CTCTGGGCCCCTTCCTCTCACGG - Intronic
1103961345 12:124610968-124610990 TGTTGGGGCCCCTGCTCTCCAGG + Intergenic
1104753216 12:131252918-131252940 GGCAGTGCCCCTTCCTATCCAGG + Intergenic
1105014421 12:132777448-132777470 TGCTGGGGCGCTTTCTCTCTTGG + Intronic
1107828117 13:44349541-44349563 GGCCGGCTCCCTTCCTCACCTGG - Intergenic
1112072792 13:95873646-95873668 AGATGGAGCCCTTCCTGTCCAGG + Intronic
1112504841 13:99969569-99969591 GGAGGGGTCCCTTCCCCTCCCGG + Intronic
1113533222 13:111044841-111044863 GACTGTGCCCCTGCCTCTCCAGG - Intergenic
1113747372 13:112754612-112754634 GTCTGGGGCTCAACCTCTCCAGG - Intronic
1113871483 13:113562479-113562501 GGCTGAGCCTCTTCCCCTCCCGG + Intergenic
1113944842 13:114038348-114038370 CGCTGGGGCCCTTGTGCTCCGGG + Intronic
1114516299 14:23302131-23302153 GGCGGGGGCACCTCCCCTCCTGG - Intronic
1117742519 14:58833651-58833673 GTCTGGAGCCCTTGCTCTCTTGG - Intergenic
1119341908 14:73886662-73886684 GGCTGCGGCTCCTCCTGTCCGGG + Exonic
1119342027 14:73887093-73887115 GGCTTTGGCCCTTCCCCTCGCGG + Intronic
1121767880 14:96502833-96502855 GGCCGGGGGCCTTCCCCTTCCGG + Intronic
1122233424 14:100318632-100318654 GCCCGGGGCTCTGCCTCTCCCGG - Intergenic
1122549777 14:102543676-102543698 TGCTGGGCACCTCCCTCTCCAGG + Intergenic
1122823039 14:104356597-104356619 GGCTGGGGCCCAGCAGCTCCAGG + Intergenic
1122859027 14:104573992-104574014 GGGTGGGGCCCTCCCTCCCCCGG + Intronic
1124441476 15:29689096-29689118 CGCTGGAGCCCTCCCTCTCTGGG + Intergenic
1125471494 15:40008689-40008711 GGTTTGGGCCCTTTCTCCCCAGG + Intronic
1125516713 15:40324659-40324681 GGCTGCGGGCCTCCCGCTCCGGG - Intergenic
1126362452 15:47860492-47860514 GGGTGGGTCCCTGCTTCTCCAGG - Intergenic
1127429386 15:58887286-58887308 GGATTGGGCCCTGCCTCTCGAGG + Exonic
1128367076 15:67012099-67012121 GGCTGGTGGCCTTCCTGTCCAGG - Intergenic
1128565766 15:68699701-68699723 GGCTGGATCCCAACCTCTCCTGG + Intronic
1129250855 15:74308179-74308201 GGCTGGAGCCCCTCTTGTCCAGG + Intronic
1130980864 15:88811058-88811080 GACAGGGGCCCTTCCTCCCTTGG + Intronic
1132723469 16:1328102-1328124 GGCTTGGGCTCTTCCTTCCCTGG + Intergenic
1132830340 16:1924887-1924909 GGCTGGGGCCACCCCTCTGCAGG - Intergenic
1133038283 16:3046580-3046602 GCCAGCGGCCCCTCCTCTCCGGG - Intergenic
1133101258 16:3481513-3481535 GGCTGGGTCTCTTCCTCCTCTGG + Intronic
1133232756 16:4374224-4374246 GGCTGAGGCCCTGCCCCTCCTGG - Intronic
1134101081 16:11451966-11451988 GGGTGGGGACCTGGCTCTCCAGG - Intronic
1136237683 16:28924871-28924893 GGCCGCGCCCCTTCCTCACCGGG + Intronic
1136583764 16:31170366-31170388 GACAGGGGCACTTCCTGTCCTGG + Intergenic
1137402919 16:48167740-48167762 CACCAGGGCCCTTCCTCTCCAGG + Intronic
1138142758 16:54582896-54582918 GGTGTGGGCCCTTCCCCTCCCGG + Intergenic
1139353277 16:66351219-66351241 TGCTGGGACCCTTTATCTCCTGG - Intergenic
1139593075 16:67943887-67943909 GGCTGGGGCCCAGGCTCCCCAGG + Exonic
1139806067 16:69566227-69566249 GGCGGCGGCACCTCCTCTCCGGG - Exonic
1139918099 16:70440288-70440310 GACTGGGACCCTGCCTTTCCGGG - Intergenic
1140043725 16:71426004-71426026 AGCTGGGGTCCTCCGTCTCCAGG - Intergenic
1141164586 16:81652028-81652050 GGATGAGACCCTTCCTCTCTCGG + Intronic
1142027546 16:87822692-87822714 CTCTGGGGCTCTTCGTCTCCAGG - Intergenic
1142156072 16:88533390-88533412 GCCTGGGGCCCAGGCTCTCCGGG - Exonic
1142156601 16:88535255-88535277 GGCAGGGGCCCAGCCACTCCGGG - Exonic
1142223657 16:88867048-88867070 TGCTCAGGCCCTGCCTCTCCTGG - Intergenic
1142808927 17:2386313-2386335 GGCTGAGGCCCCACCTGTCCGGG + Exonic
1143375154 17:6462942-6462964 GGCTGTGGTCCTTCCTCTCTGGG - Intronic
1144522544 17:15963547-15963569 GGCAGGAGCCCTTTCTCTCAGGG + Intronic
1144788403 17:17844366-17844388 GGCTGGGTCCTCTCCTCCCCAGG + Intronic
1145068683 17:19783809-19783831 GGCTTCGGCTCTTCCCCTCCAGG - Exonic
1145239763 17:21233811-21233833 GCCTGTGGCCCTGCATCTCCTGG + Intergenic
1147178764 17:38672537-38672559 GGCTGAGGGACCTCCTCTCCTGG - Exonic
1148123480 17:45225281-45225303 AGCTGGGGCCCTTCCCTTCTGGG + Intronic
1148388603 17:47254092-47254114 AGCTGGGGACCTTCCTGGCCCGG + Intronic
1148664089 17:49361890-49361912 GGAAGGGGCCCTTACTCACCCGG + Intronic
1148798110 17:50207119-50207141 GGCTGCTGCCCTTTCTCCCCTGG - Intergenic
1151234202 17:72706823-72706845 GGCTGGGGCCCAGGCTCTTCAGG - Intronic
1151249423 17:72822048-72822070 GGCTGGGGCCATTTCTCCCTGGG + Intronic
1151282713 17:73088708-73088730 TGCTGGGGACCTTCTTCACCTGG - Exonic
1151673303 17:75584940-75584962 TGCTGTGGCCTTTCCTCACCAGG - Intergenic
1151685075 17:75641464-75641486 GGCTGGTGCCCGTCCTTCCCAGG + Intronic
1152253783 17:79225785-79225807 GGCTGGGCCCATTCCACACCAGG + Intronic
1152555028 17:81048870-81048892 GGCAGGGACCCCTCCTCTCCCGG + Intronic
1152629373 17:81403209-81403231 GGCTGGGCCCGCTCCTGTCCTGG + Intronic
1154281334 18:13005727-13005749 GACTGAGGCCATGCCTCTCCAGG - Intronic
1155221529 18:23689894-23689916 GGCTGGGGCCTCCCCTCGCCGGG - Exonic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1156004925 18:32428738-32428760 GTCTGGGGCCCCTCCTCTGGGGG - Intronic
1160370378 18:78368282-78368304 GGCGGGGGAGCTTCCTCCCCTGG + Intergenic
1160442453 18:78902894-78902916 GTCAGGGGCCATTCCTCTCAGGG - Intergenic
1160488778 18:79319397-79319419 GGAGGGGCCCCCTCCTCTCCTGG + Intronic
1160837817 19:1132826-1132848 AGCCTGGGCCCCTCCTCTCCAGG + Intronic
1160866224 19:1257337-1257359 GGCTGGGCCACGTTCTCTCCGGG - Exonic
1161316736 19:3620778-3620800 GGCTGATCCCCTTCTTCTCCAGG + Exonic
1161640442 19:5419277-5419299 GGCTGGTGCCCCGCCCCTCCTGG - Intergenic
1161680000 19:5675230-5675252 GGCTGGTGTCCTTCATCCCCAGG - Intronic
1161783604 19:6309834-6309856 AGCTGAGCCCCTTCCTCCCCAGG - Exonic
1162063789 19:8112172-8112194 GGCAGGGACTCTTCCTCTCTAGG + Intronic
1162426822 19:10602320-10602342 GGTTGGGGCCCCACCCCTCCCGG + Intergenic
1162515213 19:11143245-11143267 GGCTGGGCCCACTCCACTCCCGG + Intronic
1162947715 19:14053897-14053919 GGCTGGGGTCCTTCCTTCTCTGG + Exonic
1163104610 19:15116133-15116155 GGCGGGGGCCCTTCCTTACCAGG + Exonic
1164302072 19:23971761-23971783 GGCGGGGCCGCTTCCTTTCCAGG - Intergenic
1164882225 19:31741923-31741945 GGCTAGTGCCCTTCCTCCCTAGG + Intergenic
1165707687 19:37988097-37988119 GGCTCCTGCCCTACCTCTCCTGG + Intronic
1165829162 19:38722012-38722034 GGCTGGGGCCCATCCCATCAGGG - Intronic
1165832824 19:38737559-38737581 GGCTGGGGCCCAGCACCTCCGGG + Exonic
1166053497 19:40274955-40274977 GGAGGCAGCCCTTCCTCTCCAGG + Intronic
1166598421 19:44072122-44072144 GGTAGGGGCACTTCCGCTCCCGG + Exonic
1167665305 19:50820044-50820066 GGCTGCAGCCCTTTTTCTCCCGG - Intronic
1167981812 19:53282192-53282214 GAGTGGGGCCCTTCCTCTGCAGG + Intergenic
1167984280 19:53301470-53301492 GAGTGGGGCCCTTCCTCTGCAGG - Intergenic
1168078053 19:53991439-53991461 GGCTCGGCCCCTTCCTCCCCGGG + Intergenic
1168233692 19:55048793-55048815 GGCTGGGGTCTGTCCTCACCGGG - Intronic
1168353639 19:55689630-55689652 GGCGGGTGCCCGTCCTCCCCGGG + Intronic
1168357839 19:55713547-55713569 GCCAGGGGCACTTTCTCTCCTGG - Intronic
925386081 2:3462795-3462817 GGCTTGGGCCCCCCCTCCCCCGG + Intronic
926018578 2:9474967-9474989 GGCAGCGGCCTTTCCCCTCCGGG + Intronic
927448641 2:23187595-23187617 GGGTGGAGCCCTGCCTCTCAGGG + Intergenic
927481482 2:23457441-23457463 TTCTGGGGCCCTTCCCCTCCAGG + Intronic
927717905 2:25364361-25364383 GTCTGGGGCCCTGCTTCTCAGGG - Intergenic
930198332 2:48530251-48530273 GCCTGGGACCCCCCCTCTCCAGG + Intronic
931184561 2:59937572-59937594 GGCTGGGGGCCTTCCTGTCTAGG - Intergenic
932281719 2:70498634-70498656 GGATGCTGCCCCTCCTCTCCTGG + Intronic
932336330 2:70933285-70933307 GGCTGCAGCCCCTCCTCTCCGGG - Exonic
932435855 2:71702271-71702293 GGCTGGGGCCCTGCCTGCCCGGG + Intergenic
932769292 2:74491634-74491656 TGCTGGGGCCTCTCCTCTCTTGG - Exonic
934103403 2:88674518-88674540 ACCTGGGGCCCTTCCCCTACTGG + Intergenic
934622888 2:95826331-95826353 GGCTGCCGCCCTTCCTCCCCAGG + Intergenic
934810882 2:97275772-97275794 GGCTGCCGCCCTTCCTCCCCAGG - Intergenic
934826810 2:97432167-97432189 GGCTGCCGCCCTTCCTCCCCAGG + Intergenic
935265155 2:101387404-101387426 GGCCGGGGACCCGCCTCTCCTGG - Exonic
936057979 2:109275722-109275744 GCCGGGTACCCTTCCTCTCCCGG + Intronic
938070446 2:128305572-128305594 GGCTGAGGCCCTTGTTCTCCAGG + Intronic
938248432 2:129796370-129796392 AGCTGGGGCCCTCCCTCACATGG - Intergenic
941006855 2:160257106-160257128 GGCTGGGGCCATTCCCATCTTGG - Intronic
941095726 2:161238087-161238109 GCCTGTGGCGCCTCCTCTCCCGG + Intergenic
942327889 2:174790929-174790951 GAGTGGGGCCAGTCCTCTCCTGG + Intergenic
944347295 2:198684617-198684639 GGCTGGGGCATTGCCTCACCTGG + Intergenic
946190761 2:218006645-218006667 AGCTGGGGCCTGTCCTCACCAGG - Intergenic
947564482 2:231185385-231185407 TGCTGTGGAGCTTCCTCTCCTGG - Intergenic
947713375 2:232328312-232328334 GGCTGGCTTCCCTCCTCTCCAGG + Intronic
947871650 2:233441999-233442021 GGCTGGGCTCCCTCCTGTCCTGG - Intronic
948061621 2:235046659-235046681 TGCCGGGGCCCTTCCTCTCATGG - Intronic
948584895 2:239013190-239013212 GGCTGGGACCTGTCCTCTGCAGG + Intergenic
948883316 2:240871181-240871203 GGCTGGGGCATCTCCGCTCCGGG - Intronic
1169044956 20:2527836-2527858 TGCTGGGGACTTTGCTCTCCTGG + Intergenic
1169468747 20:5864561-5864583 GGCATGAGCCCTTCCTCACCAGG + Intergenic
1171279680 20:23885114-23885136 GGCTGGGGCCAGGCCACTCCTGG - Intergenic
1172092151 20:32440862-32440884 GCCTGGGTCCCCTCCTCTCAGGG - Intergenic
1172115781 20:32572733-32572755 GGCTGGGGCCCTGTCAATCCTGG + Intronic
1172671256 20:36635761-36635783 GGGAGGGCCCCTTCCCCTCCTGG + Intronic
1173224923 20:41156839-41156861 GGCAGAGGCCATTCCTCTCTGGG + Intronic
1174138797 20:48398608-48398630 GGCAGGAGCCCTGCCTTTCCAGG - Intergenic
1174190943 20:48740084-48740106 GCCAGGGCCCCTTCCTCTCCTGG + Intronic
1174400605 20:50273849-50273871 GTCCTGGACCCTTCCTCTCCAGG + Intergenic
1174588291 20:51625428-51625450 GGGTGTGGCCCTTCCACTCTTGG - Intronic
1175082530 20:56433095-56433117 GGGTGTGGCCCTCGCTCTCCTGG + Intronic
1175891328 20:62317314-62317336 GCCCAGGGCCCCTCCTCTCCTGG + Intronic
1176002871 20:62840820-62840842 GCCAGGGGCGCTCCCTCTCCTGG - Exonic
1176388126 21:6149874-6149896 GGCTCCTGCCCTCCCTCTCCAGG + Intergenic
1177388200 21:20433791-20433813 GCCTGGGTCCCTCCCTCACCTGG - Intergenic
1179095059 21:38306702-38306724 GGCTGCTATCCTTCCTCTCCTGG - Exonic
1179473639 21:41629296-41629318 ACCTGGGGCCCTTCCCCACCTGG + Intergenic
1179601961 21:42485245-42485267 AGCTGGGGGTCTTCCTCCCCAGG + Intronic
1179735346 21:43388374-43388396 GGCTCCTGCCCTCCCTCTCCAGG - Intergenic
1180135535 21:45859680-45859702 GGCTGGGCACCTCCCTCTCCAGG + Intronic
1180700335 22:17778129-17778151 GCCAGGTGGCCTTCCTCTCCCGG + Intergenic
1180951490 22:19722558-19722580 GGCTGTGGCCCCGCGTCTCCGGG - Exonic
1180959194 22:19755052-19755074 GGCTTGGGTCCCTCCACTCCAGG + Intergenic
1181040084 22:20187972-20187994 GCCTGGGGTCCTTGCTCACCAGG - Intergenic
1181050188 22:20234660-20234682 GGCTGGGGCCCTGGCTCCCAAGG + Intergenic
1182519786 22:30878818-30878840 GCCGGGTGCCCTTCCTCCCCAGG - Intronic
1183279183 22:36923048-36923070 GGTTGCGGACCCTCCTCTCCTGG - Intronic
1183310037 22:37104591-37104613 GTCTGGAGCCTTTGCTCTCCCGG - Intronic
1184066689 22:42125520-42125542 GGCTGTGGCCCTTGCTGGCCTGG - Intergenic
1184069157 22:42137672-42137694 GGCTGTGGCCCTTGCTGGCCTGG - Intergenic
1184089181 22:42283508-42283530 CCCTCGGGCCCCTCCTCTCCCGG + Intronic
1184386807 22:44181392-44181414 GGCCAGGCCCCTTCCTCTCCCGG - Intronic
1185058737 22:48594488-48594510 GGCTGGGCCCCACCCTCTCAGGG + Intronic
1185277281 22:49955236-49955258 GGCTGGGGCCTATCCTGTCTGGG + Intergenic
1185333453 22:50261640-50261662 CGCTGGGGCGCTCCCGCTCCCGG + Exonic
1185346625 22:50313386-50313408 GGCGGGTTCCCTTCCTCACCCGG - Intronic
950489873 3:13297674-13297696 AGCTGGGTCCCTTGCTCTCTGGG + Intergenic
950637714 3:14326950-14326972 GGCTGGGGCTCTGACTCTGCTGG + Intergenic
950692358 3:14670025-14670047 GCTTGGTGTCCTTCCTCTCCTGG - Exonic
953850751 3:46464076-46464098 GGCCTGGGACCTTCCCCTCCCGG + Intronic
953876909 3:46671730-46671752 GGCTGGGACCCTCCCTTTTCTGG + Intronic
954617633 3:51977761-51977783 GGCTGGAGCTCTTCCTCTGCTGG + Intronic
955374642 3:58384950-58384972 GGCTAGGGCCCTCCCTCTCTGGG - Intronic
960586077 3:119322750-119322772 GGCTGGGGCCCGGCCGCTCTGGG + Intronic
961200605 3:125042706-125042728 AGCAGGGGCCCTTCCCCTGCAGG + Intronic
961514058 3:127422062-127422084 GACTGGCGCCCTTCCACACCTGG - Intergenic
961611674 3:128144644-128144666 AGGTGAGGCCCTTGCTCTCCAGG + Intronic
964942389 3:162174821-162174843 GGCAGGGGTGCTTCATCTCCAGG + Intergenic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
968531495 4:1094268-1094290 GGAAGGACCCCTTCCTCTCCTGG + Intronic
968593795 4:1472401-1472423 GGCTGGGACCCCCCCACTCCTGG + Intergenic
968618306 4:1592412-1592434 GGCTTGGGCCCTGCCCCTCCGGG - Intergenic
969206373 4:5650113-5650135 GGATTGGGCCTTCCCTCTCCAGG + Intronic
969310848 4:6352323-6352345 GCCTGGGCCCTTTCCTTTCCAGG + Intronic
969323379 4:6426467-6426489 GTCTGGGGCTCTGTCTCTCCTGG - Intronic
969620877 4:8278266-8278288 TGTTGCGCCCCTTCCTCTCCTGG + Intronic
969702177 4:8773713-8773735 GGCTGCGCCCCTTCATCTGCAGG - Intergenic
972302361 4:37797003-37797025 GGCTGGGGTCATTCCTTGCCAGG - Intergenic
975469377 4:74747497-74747519 AGCTGTTGCCCTTCCTCTACAGG - Intronic
975679974 4:76866966-76866988 GGCGGGGACCCTTCCTCATCTGG - Intergenic
976375649 4:84342400-84342422 GGCTGCTGCCCTTCCCCTCTGGG - Intergenic
985474998 5:73936-73958 GGCTGGGGCCCTGACCCTGCAGG - Intergenic
985524716 5:396109-396131 GGCTGGGACCCTCCCGCTCCTGG - Intronic
985679701 5:1249469-1249491 GGCTGGGGACTTACCACTCCAGG + Intergenic
987177157 5:15325481-15325503 GGCTGGTGGCCTGCCCCTCCTGG + Intergenic
988076598 5:26362644-26362666 GGCTGCTGCCCTTCCCCTCTGGG + Intergenic
991283318 5:64940391-64940413 GGGTGGGGCGCTGCCTCACCGGG - Intronic
993057315 5:82996920-82996942 GGATGGGGCCCTTCATCTACAGG + Intergenic
996954810 5:129170105-129170127 GGCTATGGCCCATCCTTTCCTGG - Intergenic
997262082 5:132473133-132473155 GGCTGGGTCCTTTTCTCCCCTGG + Intronic
997262462 5:132475382-132475404 GGCTGGGGCCTTGCCTCCCGTGG - Intronic
997589506 5:135064186-135064208 GGCTGGAGCAGCTCCTCTCCGGG - Intronic
998159675 5:139806326-139806348 GGTTTGGGCCCTTGATCTCCTGG + Intronic
1001431719 5:171667609-171667631 GGCCTGCGCCCTTCCCCTCCGGG + Intergenic
1001641261 5:173245800-173245822 GACTGGGGCCCTTCCGCTCGGGG + Intergenic
1001961086 5:175880647-175880669 GGCAGGGGCCATGTCTCTCCAGG - Exonic
1002409080 5:179060277-179060299 GGCGGAGGCGGTTCCTCTCCCGG + Intergenic
1002702379 5:181133778-181133800 GGGTGGTGCTTTTCCTCTCCAGG + Intergenic
1003086414 6:3064502-3064524 GGATGGGGCCCTTCCTTCCCCGG + Intronic
1005966170 6:30728190-30728212 GGCTGAGGCCCCTACTCTCCCGG + Intronic
1006104176 6:31706701-31706723 GGCTGGGTCCTTTTCTCTCCAGG + Intronic
1006386107 6:33731858-33731880 GGCTGGGTCCCACACTCTCCTGG - Intronic
1006535682 6:34696898-34696920 GGCCCCGCCCCTTCCTCTCCCGG + Intergenic
1008879885 6:56371426-56371448 GGCTGGGCACCTGACTCTCCTGG - Intronic
1009536592 6:64896296-64896318 GGGTGGGGCACTGCCTCACCTGG + Intronic
1009861274 6:69336430-69336452 GGCTGGCGCATTTCCTTTCCAGG + Intronic
1010238418 6:73594459-73594481 GGCTGGTGCCTTTCCTCTGAGGG - Exonic
1014089344 6:117385701-117385723 GGCTGGGTCACTTTCTCTACTGG - Exonic
1017652884 6:156599272-156599294 GCCTGGGGCCCTTTCTGGCCAGG - Intergenic
1019143383 6:169962095-169962117 GGCCGGGGCGCCTCCTCACCGGG + Intergenic
1019522449 7:1466978-1467000 GGCTGGGACCCTGCCTGGCCTGG + Intergenic
1019542460 7:1557778-1557800 GGCTGAGGCCCATCCTTCCCTGG + Intronic
1019640532 7:2101233-2101255 GGCTGTGGCCCTTCCCCCCAGGG - Intronic
1019655620 7:2193314-2193336 GGCGGGGACGCTTTCTCTCCAGG - Intronic
1021119157 7:16778443-16778465 GGCTGGGTCCTTTGCTCACCTGG + Intronic
1021923572 7:25512757-25512779 GCCTGTGGGCCTTCCTCTCCTGG - Intergenic
1022091275 7:27109493-27109515 GCCTGGGGCCTTTCCTCTACTGG + Intronic
1022547042 7:31199530-31199552 GGCAGGGGCACCTCCTCTCCAGG + Intergenic
1023059626 7:36315246-36315268 GGCTGGGGACCGTCCACCCCTGG - Intergenic
1023837525 7:44077099-44077121 GGCTGGGGCCCACCCTCTGTGGG - Intronic
1024345573 7:48310158-48310180 GGCTGGGGGCAGTCCTCTGCAGG + Intronic
1024821389 7:53334755-53334777 AGCTGGGACCCTTCCCCTCAGGG - Intergenic
1024926690 7:54623186-54623208 TGCTGGGACCCTTCATCTCTGGG - Intergenic
1025106485 7:56175230-56175252 GGCGGGGGGGCGTCCTCTCCAGG + Intergenic
1026028046 7:66762892-66762914 TGCTGTGGCCCTTGCTGTCCAGG - Intronic
1028801488 7:94970425-94970447 GGTTGGGGCATTGCCTCTCCCGG - Intronic
1029545304 7:101207408-101207430 GCCTGGCGCCCTCCCTCCCCTGG + Intronic
1032012912 7:128358741-128358763 GGCTGGAGAGCTTCCTCTCCAGG + Exonic
1032706600 7:134425336-134425358 GGGAGGGCCCCTTGCTCTCCAGG - Intergenic
1034069858 7:148173995-148174017 GGCAGGGGCATATCCTCTCCAGG + Intronic
1035582695 8:749854-749876 GGGAGGGTCCCCTCCTCTCCTGG + Intergenic
1035640883 8:1184459-1184481 GGCTGAGGCCATTCTTCTCTGGG + Intergenic
1035742989 8:1943289-1943311 GAATGGGGCCCTGTCTCTCCTGG - Intronic
1036637935 8:10564421-10564443 GGCTGTGGCCCTTCCCCCACTGG + Intergenic
1037820925 8:22134166-22134188 GCCTGGGGCCCTCCGTGTCCTGG - Intergenic
1038136937 8:24796510-24796532 AGCTGGGTGCCTTCTTCTCCAGG + Intergenic
1038317936 8:26503367-26503389 GACTGAGCCCCTTCCCCTCCAGG + Intronic
1038761116 8:30384780-30384802 GGCTCCCGCCCTCCCTCTCCAGG + Exonic
1038840189 8:31177650-31177672 GGTTGGAGACCTTCCTCTACCGG - Intergenic
1040451755 8:47554698-47554720 GGGTGGGGCACTGCCTCACCCGG - Intronic
1045332375 8:101166479-101166501 GGCTTTGGCCCTTCCTCTCAGGG - Intergenic
1047520754 8:125593847-125593869 GGCAGGTGCCCTCCCTTTCCTGG + Intergenic
1047914562 8:129568067-129568089 GGCTTGGGCCCTTCCCAACCTGG + Intergenic
1048448765 8:134513003-134513025 GGCTGTGCCCCTTCCTCTGTTGG - Intronic
1048974251 8:139662251-139662273 GGCTGGGGTCCTTCCTGCCCAGG + Intronic
1049166370 8:141128545-141128567 GGCTCGGGCCCCGCCCCTCCAGG + Intronic
1049202827 8:141350241-141350263 GGCTGGGGCCACCACTCTCCTGG - Intergenic
1049329419 8:142042393-142042415 GGCCGGGGCCCATCCTCAGCTGG - Intergenic
1049465363 8:142749040-142749062 TCCCGGGCCCCTTCCTCTCCAGG + Intergenic
1049485686 8:142858809-142858831 CACAGAGGCCCTTCCTCTCCAGG - Intronic
1049661248 8:143820570-143820592 TGCTGGGGACCTTGCTCCCCTGG - Intronic
1049673916 8:143881297-143881319 TCCTCTGGCCCTTCCTCTCCTGG - Intergenic
1049683050 8:143928212-143928234 GGCTGGCGCACCCCCTCTCCAGG - Intronic
1049776040 8:144405659-144405681 GGCTGTCTCCCTCCCTCTCCAGG + Intronic
1049788812 8:144463625-144463647 GCCCTGGGCCCTTACTCTCCAGG - Intronic
1050504686 9:6336029-6336051 GGGTGGGGCACTGCCTCACCCGG + Intergenic
1052374364 9:27701219-27701241 GGTGGGGGCACTTCCTCTCAGGG + Intergenic
1055625653 9:78174804-78174826 GCCTTGGGCCTTTCCTCTCATGG + Intergenic
1056517952 9:87372696-87372718 GGTTGGGTCCCTTCCCCGCCTGG - Intergenic
1056833217 9:89933218-89933240 GGCAGAGGCCCATCCTTTCCTGG - Intergenic
1058152272 9:101476259-101476281 TGCTGGGGCCCTTACTAACCTGG - Exonic
1058700964 9:107599848-107599870 CACTGTGGCCCTTCCTGTCCTGG + Intergenic
1059441638 9:114310778-114310800 GGCAGGGGAGCTGCCTCTCCTGG - Exonic
1060468697 9:123930021-123930043 GGCTGGGGCCCGCCCGCTCGAGG + Exonic
1060918277 9:127403893-127403915 AGCTGGGTCCCTCCCTCTCCAGG - Intronic
1061508883 9:131048626-131048648 GGCTGGGCCCCTTCCTAACCAGG + Intronic
1061672120 9:132194618-132194640 GGCTGGGGCCAGTCCTACCCTGG + Intronic
1061678641 9:132231841-132231863 GCCTGGGTCCCTGCCTCTCTTGG + Intronic
1061757743 9:132827120-132827142 GGCTGGGGTGCTTGCTGTCCTGG + Intronic
1061999918 9:134210764-134210786 GGCTGTGGCCCTTCAGCGCCAGG - Intergenic
1062150329 9:135014955-135014977 GGCTGGGGCGCTGCCTCTGGGGG + Intergenic
1062150588 9:135016727-135016749 AGCTGGGGCACTGCCTCTCGTGG + Intergenic
1062181131 9:135191854-135191876 GGCTGGGTCCCATCCTGGCCAGG - Intergenic
1062359964 9:136183012-136183034 TGCTGGGGCCTCACCTCTCCAGG - Intergenic
1062620301 9:137417533-137417555 GGCTCTGGCAGTTCCTCTCCCGG + Intronic
1062729024 9:138098019-138098041 GGATGGGGCCTCTCCTGTCCAGG + Intronic
1187270540 X:17776089-17776111 GGCTGGGGAGCTTGATCTCCTGG + Intergenic
1187319968 X:18229636-18229658 GGCTGGGGAGCTTGATCTCCTGG - Intergenic
1189141190 X:38608010-38608032 GGCTGGGGTCCTTCCCTACCAGG - Intronic
1190041869 X:47078409-47078431 CGCCGGGGCCTTTCCTTTCCAGG - Exonic
1190458113 X:50644681-50644703 TGCTAGGGCCTTTCCTCTCTGGG + Intronic
1190511267 X:51176318-51176340 GGCTGGTAAACTTCCTCTCCTGG + Intergenic
1190734742 X:53248782-53248804 GGCTGAGGCCTTTCCGCTCCAGG + Exonic
1191670114 X:63740956-63740978 GGCAGTGGCCCATCCTCTCCTGG - Intronic
1194930496 X:99881344-99881366 GCCTGGGTCCCTTCCACACCTGG - Intergenic
1194977572 X:100409632-100409654 GGCGGCGGCCCCGCCTCTCCTGG - Exonic
1196759296 X:119186944-119186966 TGCTGGGGCTCCTGCTCTCCTGG + Intergenic
1196892392 X:120304030-120304052 GGCTAAGGTCCTTTCTCTCCGGG - Intronic
1198692641 X:139301064-139301086 GCCCGGGCCCCTCCCTCTCCTGG + Intergenic
1199010775 X:142756120-142756142 AGCTGGGACGCTTCTTCTCCTGG + Intergenic
1200093220 X:153645308-153645330 GGCTGGGGCCCTTGCCCACTGGG + Intronic
1200746909 Y:6911102-6911124 AGCTGGGGCCCTGCGTCTCCAGG - Intronic