ID: 1084118795

View in Genome Browser
Species Human (GRCh38)
Location 11:67056952-67056974
Sequence GCCCACCAGGACCACCTTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084118795_1084118803 25 Left 1084118795 11:67056952-67056974 CCGTCAAGGTGGTCCTGGTGGGC 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1084118803 11:67057000-67057022 TGCTGATGGTCTTCGCCGATGGG 0: 1
1: 0
2: 0
3: 4
4: 25
1084118795_1084118801 11 Left 1084118795 11:67056952-67056974 CCGTCAAGGTGGTCCTGGTGGGC 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1084118801 11:67056986-67057008 CGGGAAGACGTCGCTGCTGATGG 0: 1
1: 0
2: 3
3: 7
4: 58
1084118795_1084118802 24 Left 1084118795 11:67056952-67056974 CCGTCAAGGTGGTCCTGGTGGGC 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1084118802 11:67056999-67057021 CTGCTGATGGTCTTCGCCGATGG 0: 1
1: 0
2: 0
3: 5
4: 37
1084118795_1084118799 -9 Left 1084118795 11:67056952-67056974 CCGTCAAGGTGGTCCTGGTGGGC 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1084118799 11:67056966-67056988 CTGGTGGGCGACGGCGGCTGCGG 0: 1
1: 0
2: 2
3: 33
4: 311
1084118795_1084118804 26 Left 1084118795 11:67056952-67056974 CCGTCAAGGTGGTCCTGGTGGGC 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1084118804 11:67057001-67057023 GCTGATGGTCTTCGCCGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1084118795_1084118800 -8 Left 1084118795 11:67056952-67056974 CCGTCAAGGTGGTCCTGGTGGGC 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1084118800 11:67056967-67056989 TGGTGGGCGACGGCGGCTGCGGG 0: 1
1: 0
2: 2
3: 25
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084118795 Original CRISPR GCCCACCAGGACCACCTTGA CGG (reversed) Exonic
900826035 1:4927784-4927806 GGCCACCAGGACCAAATGGATGG - Intergenic
901026356 1:6280625-6280647 GCAGGCCAGGACCACCTGGAGGG + Intronic
901259687 1:7862257-7862279 GCCCAGCAGGCCCACTGTGAGGG - Intergenic
901671309 1:10857879-10857901 ACCCACCAGGCCCACAGTGAGGG - Intergenic
902510642 1:16965318-16965340 CCCGACCAGGAGCACCATGAGGG - Intronic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
903888916 1:26556930-26556952 GCCCACCAGGAGCCCCATGCAGG - Intronic
907745684 1:57211298-57211320 GACCCCAAGGACCATCTTGAGGG + Intronic
908333160 1:63091782-63091804 GCCCTCCTGGATGACCTTGAGGG - Intergenic
909440153 1:75687859-75687881 GCCCACTAGTATCACCTTTATGG + Intergenic
912715274 1:111979138-111979160 ACCCACCAGGTCCACGTTCAGGG + Intronic
914242302 1:145859868-145859890 GCCCGCCAGGACCGCCAAGAGGG + Intergenic
915553126 1:156646608-156646630 GTCCTCCAGGACCACCCCGACGG - Intronic
916016113 1:160751101-160751123 TCCCACTTTGACCACCTTGATGG + Intronic
917445080 1:175099941-175099963 GTCCAAGAGGACCACCTAGAGGG - Intronic
920038091 1:203078324-203078346 GCCCATCAAGAGCACCCTGAAGG - Exonic
1068885255 10:62091343-62091365 GCCCAGCTGGTCCACCTTCACGG - Exonic
1069425915 10:68288555-68288577 GCCCACCAGGCTCTCCTTTAAGG + Exonic
1069598363 10:69687204-69687226 GGCCACCAGGACCACCAAGCTGG - Intronic
1070746120 10:78935011-78935033 GCCCATCAGGATCACATGGATGG - Intergenic
1073107137 10:101038665-101038687 GCCCACCAGTCCCACCTGCAGGG - Exonic
1073482990 10:103798640-103798662 GCTCACCAGGCCCACCTCCAAGG - Intronic
1076563340 10:131381686-131381708 GCGCACCAGGACCAGGTGGAGGG - Intergenic
1077032748 11:477045-477067 GCCCACAGGGACCACCTTTCTGG - Intronic
1077080472 11:722606-722628 GCCCACCAGGACCCCCTTGCTGG - Intronic
1078275345 11:9839655-9839677 CCCCACAAGTACCACCCTGAAGG - Exonic
1080298777 11:30760334-30760356 GCCCACCAGTATCACGTTGGTGG - Intergenic
1083687207 11:64383656-64383678 GCCCACCCTGAGCACCTAGATGG - Intergenic
1084021841 11:66422443-66422465 GGCAACCAGGTCCACCTGGAGGG - Exonic
1084118795 11:67056952-67056974 GCCCACCAGGACCACCTTGACGG - Exonic
1084394596 11:68900916-68900938 GCCCAGCAGGGCCATCTTGGAGG - Intronic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084510348 11:69599505-69599527 GCCCACCAGGCACACCCTGCAGG + Intergenic
1092183711 12:6463322-6463344 ACCCACCAGCCCCACCTTGGGGG - Intronic
1096482613 12:51952217-51952239 GCCCCCCAGGAGCACCTGGAGGG - Intronic
1097173676 12:57130642-57130664 ACCCATCAGGAGCCCCTTGAAGG + Intronic
1100786791 12:98087311-98087333 ACCCACCTGGAACACCTGGATGG - Intergenic
1101500249 12:105297809-105297831 TCCCAGCAGAACCACATTGAAGG + Intronic
1101758214 12:107638241-107638263 GACCACCAGGACCACCGTCTGGG + Intronic
1103022721 12:117549063-117549085 GCCACGCAAGACCACCTTGAAGG + Intronic
1103073346 12:117962895-117962917 CCCCACCAGGCCCGGCTTGATGG + Intronic
1103275731 12:119710372-119710394 GCCCACCAACACCACCTGCAAGG + Exonic
1103955072 12:124571674-124571696 TTCCTCCAGGCCCACCTTGAAGG - Intergenic
1104919666 12:132283917-132283939 GACCCCCGAGACCACCTTGACGG - Intronic
1112509696 13:99998064-99998086 GCCCTCCGGGCCCACCTTGGCGG + Intergenic
1115765464 14:36618425-36618447 GCCCAACAGGGCTACCTGGAGGG - Intergenic
1119593491 14:75912239-75912261 GCCCACCAGGGGCACTTTGCTGG - Intronic
1119880023 14:78092483-78092505 CCTCACCAGGGCCACCTTGGGGG + Intergenic
1122648041 14:103207791-103207813 GCCCACCAGCACCAGCAGGACGG - Intergenic
1128672005 15:69580779-69580801 CCCCACCATGAGCACCATGATGG - Intergenic
1128847606 15:70915335-70915357 CCCCACCAGGACCATGTGGAAGG + Intronic
1129656601 15:77528955-77528977 GGCCCCCAGGGCCTCCTTGATGG + Intergenic
1131723215 15:95194556-95194578 GCCCACAGGGGCCATCTTGAAGG + Intergenic
1132887506 16:2189143-2189165 GAGCAGCTGGACCACCTTGAAGG + Exonic
1136928442 16:34396663-34396685 GTGCACCAGGATCACCTAGAGGG - Intergenic
1136976132 16:35015141-35015163 GTGCACCAGGATCACCTAGAGGG + Intergenic
1137588111 16:49676569-49676591 GTCCACCGAGACCACCTTGCAGG + Intronic
1138553705 16:57760439-57760461 GCCCACCCGGGCCAGCTGGAGGG + Intronic
1141727411 16:85799200-85799222 GGCCACCAGGAGCCCGTTGACGG + Exonic
1147189735 17:38731372-38731394 TGCCACCAGCTCCACCTTGATGG - Exonic
1148454117 17:47801739-47801761 GCCCACTAGGCCCAGCTTGGAGG + Intergenic
1148454452 17:47803571-47803593 GCCCTCCCTGACCACCTTAAGGG + Intergenic
1149388839 17:56169823-56169845 CCCCAGCAGGAGCACCTTTAGGG - Intronic
1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG + Intronic
1150555424 17:66249824-66249846 GCCCAGGAGGAATACCTTGAAGG + Intronic
1151060718 17:71090582-71090604 GGCCACCAGGGCCTACTTGAGGG - Intergenic
1151242823 17:72771503-72771525 GCCCTCCAGGCTCACCTTGCAGG + Intronic
1152880342 17:82811143-82811165 GCCCACCATGACCACCAGAAAGG - Intronic
1153915055 18:9737957-9737979 GCCTGCCAGGACCACGTTGTTGG - Intronic
1156163589 18:34390342-34390364 TCCTACCAGGACGCCCTTGATGG + Intergenic
1156393702 18:36677616-36677638 GTGCACCAAGACCACTTTGACGG + Intronic
1160121573 18:76135025-76135047 ACCCAGCAGGACCACTATGATGG - Intergenic
1160891301 19:1380054-1380076 GGCCACCAAGGCCACCTTGTTGG - Intergenic
1161048399 19:2149566-2149588 CACCACCAAGACCCCCTTGAAGG + Intronic
1162158007 19:8692969-8692991 GCCCACCGGATCCTCCTTGAAGG - Intergenic
1162534163 19:11253353-11253375 AGCCACCTGGACCACCTAGATGG - Intronic
1164858210 19:31541849-31541871 TGCCACCAAGACCACCATGATGG + Intergenic
1165740064 19:38199644-38199666 GCACACCAGCACCACCATGGAGG + Intronic
1166170909 19:41027166-41027188 GTCCACCAGAGCCTCCTTGACGG + Intergenic
1166178140 19:41089005-41089027 GTCCACCAGAGCCTCCTTGACGG - Exonic
1167235519 19:48312265-48312287 GCCCACCAGAACCACATGGAGGG - Intronic
1167768461 19:51499594-51499616 GCCCCCCACGATCACCTGGATGG - Exonic
1168153878 19:54462770-54462792 AGCCACCAGGACCACATTGCTGG - Exonic
925893839 2:8456798-8456820 GCCCACCGAGAGCACCTGGAAGG + Intergenic
928921420 2:36532236-36532258 GCCTACCAGGACTACTTAGAAGG + Intronic
929225913 2:39511476-39511498 GCCCACAAGCACTGCCTTGAAGG + Intergenic
930019589 2:46993441-46993463 TCCCACCAGGAACATCGTGAAGG + Exonic
933627818 2:84621582-84621604 ACCCACCAAGACCATCTTGCAGG - Intronic
937278033 2:120698605-120698627 TCCCAGCACGGCCACCTTGAGGG - Intergenic
942299344 2:174547095-174547117 GTCCAACAGGGCCACCTAGAGGG + Intergenic
942438092 2:176002573-176002595 GACCACCAGGACCAGTTTCAGGG - Intronic
943734773 2:191342275-191342297 GACCACCAGTTCCATCTTGAGGG + Intronic
944755628 2:202759140-202759162 GCCCACCATGAACTACTTGAGGG - Intronic
945580970 2:211593902-211593924 GCCAACCAGGATAACTTTGATGG + Intronic
948861491 2:240754826-240754848 GCCCACCAAGAGCACCATGTGGG + Intronic
1170647960 20:18213468-18213490 GCCCACAGGGATCACCATGAAGG - Intergenic
1171990438 20:31692176-31692198 GCCCATCAGAATCACCTGGAAGG - Intronic
1172768672 20:37364379-37364401 GCCACCCAGGAGCACCGTGATGG + Intronic
1172793537 20:37522350-37522372 GCATTCCAGGAACACCTTGAAGG - Exonic
1173732059 20:45335877-45335899 GACCCCCAGGACCTCCTAGAAGG - Exonic
1174509889 20:51043036-51043058 GACCACCAGGGCCAGCTTCAGGG - Intergenic
1176132559 20:63502496-63502518 GCCCACCTGGGCCCCCTGGACGG + Intergenic
1180045429 21:45302951-45302973 GCCTCCCAAGACCACCGTGAGGG - Intergenic
1181977628 22:26742209-26742231 CCCCACCAGCATCTCCTTGAAGG + Intergenic
1183622473 22:38982513-38982535 GCCCAGCAGGACCACCAGGCAGG - Intronic
1183623327 22:38987226-38987248 GCCCAGCAGGACCACCAGGCAGG - Intronic
1183627629 22:39014422-39014444 GCCCAGCAGGACCGCCTGGCAGG - Intronic
1183652881 22:39169041-39169063 CCCCAGGAGGACCACCTTCATGG + Intergenic
952968563 3:38636622-38636644 GCCCACCAGGAGCAGCCTGGGGG - Intronic
953352638 3:42227518-42227540 GCACACCAGAATCACCTTGAGGG - Intergenic
953801496 3:46027314-46027336 GCACATCAGAACCACCTGGAGGG - Intronic
954368457 3:50158078-50158100 GCCTCCCAGGTGCACCTTGAGGG + Intronic
954406752 3:50349425-50349447 GCCCATCATGACCATCTTGCTGG - Exonic
954968299 3:54630113-54630135 GACCACCAGGACCACCTCACGGG - Intronic
961457164 3:127029984-127030006 GACCACCTGGACCAGCGTGAGGG + Exonic
961457179 3:127030057-127030079 GCCAGCCAGGCCCACCTTGGTGG - Exonic
961647465 3:128400262-128400284 GCCCACCAGCACCCTGTTGAGGG + Intronic
965641594 3:170834618-170834640 GTGCACCAGAATCACCTTGAGGG - Intronic
967863369 3:194170239-194170261 GCCCACCACTCCCACCTTCATGG + Intergenic
968134474 3:196211199-196211221 GACCAGCAGCACCACATTGAAGG + Exonic
968534366 4:1113870-1113892 GCGGGCCAGGCCCACCTTGAGGG + Intergenic
970004685 4:11399466-11399488 GCGCACCAGGAACTCCTCGATGG + Exonic
971879740 4:32355752-32355774 GCCTACCAGGACCAACCTGAGGG + Intergenic
977900800 4:102420332-102420354 GCCCACTAGAATAACCTTGATGG + Intronic
981737504 4:147968218-147968240 TCTCAATAGGACCACCTTGAGGG + Intronic
985282951 4:188305017-188305039 GTCCATCAGGCCCACCATGATGG - Intergenic
985607079 5:863532-863554 GCCCACCAGCACCTCCTGCAGGG - Intronic
986661578 5:10064719-10064741 GGCCACCAGGAGGACCCTGAAGG - Intergenic
986697738 5:10373639-10373661 GCCCTCCAGGAACATCGTGACGG - Intronic
991499200 5:67259367-67259389 GCCCCTCATCACCACCTTGAAGG - Intergenic
1002349710 5:178575580-178575602 GCTCACCTAGACCACCTAGATGG + Intronic
1003125467 6:3352118-3352140 GCCCACCAGGACCACAGATAAGG + Intronic
1004179058 6:13365229-13365251 GCCCTCCAGCACCATCTGGAAGG + Exonic
1010950632 6:82033057-82033079 TCCCACCAGTTCCACTTTGAAGG - Intergenic
1011360217 6:86515964-86515986 ACCCACCAGGTCATCCTTGAAGG + Intergenic
1015786514 6:136924242-136924264 GGCCACCATGCCCACCGTGATGG - Exonic
1018427239 6:163694498-163694520 GCCCAACAGGGCCACCTAGAAGG + Intergenic
1022273901 7:28837876-28837898 GACCACCAGGACCAGCTTCATGG - Intergenic
1022337054 7:29431861-29431883 GGCCATCAGGACCATCTGGAAGG - Intronic
1024293748 7:47826699-47826721 GCCATCCAGCACCACCATGATGG + Intronic
1024759512 7:52577930-52577952 GCTCACCAGGAGCACCCTGTTGG - Intergenic
1027774391 7:82444925-82444947 GCCCACCAGGGCCCTCTTGTAGG - Intergenic
1030088888 7:105840126-105840148 GCCCACAAGGGCCACAGTGAGGG + Intronic
1032966046 7:137099306-137099328 AACCACCAGGACCTACTTGAGGG + Intergenic
1035578911 8:727800-727822 GCACCACTGGACCACCTTGATGG + Intronic
1037177082 8:15960550-15960572 GGACACCAGGACCTACTTGAGGG - Intergenic
1039884671 8:41648176-41648198 GCACACCCGGCCCACCTTCACGG - Intronic
1039892559 8:41695094-41695116 GCCCTCAAAGACCACCTTTAAGG + Intronic
1040314176 8:46252227-46252249 GCCCACCACGACCGCCTTGAGGG - Intergenic
1041254995 8:55972327-55972349 TCTCACCAGCGCCACCTTGAGGG - Intronic
1044973862 8:97644649-97644671 GCCCACCAGGATCACCCAGCCGG - Exonic
1049046472 8:140155954-140155976 GCCCACAAGGAACACATGGAGGG + Intronic
1049529765 8:143148377-143148399 TCCCACCAGGACCTCCCAGATGG + Intergenic
1049681277 8:143919564-143919586 GCCCACCACGCCCGCCTTCACGG + Exonic
1052861862 9:33442414-33442436 GACCACCAGGCCCACGGTGAAGG + Exonic
1054769517 9:69070441-69070463 GGCCACCAGGGCCACCAGGAGGG + Intronic
1056841070 9:89998396-89998418 GCCAACCCGTACCCCCTTGATGG - Intergenic
1059746589 9:117207120-117207142 GCCCACCAGGAGCAGCCTGCAGG - Intronic
1060975314 9:127761751-127761773 CCCCAGCAGGATCACCCTGAAGG + Intronic
1061858767 9:133457207-133457229 GCCCCCCAGGACAACCGAGAGGG - Intronic
1062011278 9:134268187-134268209 GCCCACCAGGATCTGCTTGGTGG - Intergenic
1062359476 9:136180785-136180807 GCCCTCCTGGCCCACCTTGACGG + Intergenic
1062725933 9:138073597-138073619 CCCCGCCTGGCCCACCTTGAAGG - Exonic
1191874955 X:65787144-65787166 GCCCACCAGGTGCACCTGGAAGG + Intergenic
1196785843 X:119420819-119420841 GGCCACCAGGCCCAGCCTGAAGG - Intronic