ID: 1084121313 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:67070640-67070662 |
Sequence | GACCTACACCCTGAGCGTTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 45 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 40} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1084121313_1084121316 | 9 | Left | 1084121313 | 11:67070640-67070662 | CCAGAACGCTCAGGGTGTAGGTC | 0: 1 1: 0 2: 0 3: 4 4: 40 |
||
Right | 1084121316 | 11:67070672-67070694 | GTCGTCTTAGAGGCTGTCAGAGG | 0: 1 1: 0 2: 0 3: 5 4: 76 |
||||
1084121313_1084121315 | -1 | Left | 1084121313 | 11:67070640-67070662 | CCAGAACGCTCAGGGTGTAGGTC | 0: 1 1: 0 2: 0 3: 4 4: 40 |
||
Right | 1084121315 | 11:67070662-67070684 | CAGAGCTGCGGTCGTCTTAGAGG | 0: 1 1: 0 2: 1 3: 13 4: 51 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1084121313 | Original CRISPR | GACCTACACCCTGAGCGTTC TGG (reversed) | Intronic | ||