ID: 1084121313

View in Genome Browser
Species Human (GRCh38)
Location 11:67070640-67070662
Sequence GACCTACACCCTGAGCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084121313_1084121315 -1 Left 1084121313 11:67070640-67070662 CCAGAACGCTCAGGGTGTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1084121315 11:67070662-67070684 CAGAGCTGCGGTCGTCTTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 51
1084121313_1084121316 9 Left 1084121313 11:67070640-67070662 CCAGAACGCTCAGGGTGTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1084121316 11:67070672-67070694 GTCGTCTTAGAGGCTGTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084121313 Original CRISPR GACCTACACCCTGAGCGTTC TGG (reversed) Intronic
921553498 1:216568462-216568484 GTCCTACACATTGAGCTTTCAGG - Intronic
1063072022 10:2676197-2676219 GACCTTGCCCCTGTGCGTTCAGG - Intergenic
1064602894 10:17011381-17011403 GACCTTCACCATGAGTGTTACGG + Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1073446313 10:103582543-103582565 GGCCCACACCCAGAGCTTTCTGG + Intronic
1074991082 10:118708713-118708735 GAGCGAGAACCTGAGCGTTCTGG - Intronic
1078541636 11:12217896-12217918 GAGCTATAGCCTGAGCGTCCAGG + Intronic
1080475200 11:32583878-32583900 GGCCTGCACCATGAGCGTCCCGG + Exonic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084507414 11:69576884-69576906 GACCTATAACATGAGCGATCTGG - Intergenic
1085394639 11:76201112-76201134 CACCTTCTCCCTGAGCCTTCTGG - Intronic
1086126232 11:83351303-83351325 GGCCTACAGCCTGAACTTTCGGG + Intergenic
1088553210 11:111035941-111035963 GTTCTACACACTGAGGGTTCTGG - Intergenic
1089576045 11:119444782-119444804 GACCTAGAAGCTGAGCCTTCTGG - Intergenic
1108014278 13:46057714-46057736 GACCAAAACCCTGAGGGTTAGGG + Intronic
1112103615 13:96217026-96217048 GACCCACACCCTGGGGGTGCAGG - Intronic
1121533753 14:94677047-94677069 TACCTACTCCCTGACCCTTCAGG + Intergenic
1129514534 15:76148977-76148999 CACCTCCATCCTGAGAGTTCTGG + Intronic
928403985 2:31000187-31000209 TCCCTAAACCCTGAGTGTTCTGG + Intronic
934862848 2:97779063-97779085 GGCCTAGACCCTGAGGGGTCGGG - Intronic
943589800 2:189783964-189783986 GACCGACAGCCCGAGCGCTCTGG + Intronic
949027355 2:241772813-241772835 GACCTAAACCCCGAGCGCTCAGG - Intergenic
1178662591 21:34520050-34520072 GTCCTAAACCCTGAGCTTTCTGG - Intronic
954097289 3:48338606-48338628 GACCTACACTCTGGGCATCCAGG - Intergenic
957221396 3:77387462-77387484 GACCTACACCCTGGATTTTCAGG + Intronic
958255965 3:91325178-91325200 GACCTACACACTTTGGGTTCAGG + Intergenic
961799950 3:129439868-129439890 GCCCCACACCCTGGGCGTTGCGG - Exonic
964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG + Intergenic
965187457 3:165483144-165483166 GACCTACATCCTGAGCACACTGG - Intergenic
967717327 3:192777035-192777057 GACTTACACCCCTAGAGTTCAGG + Intergenic
980823695 4:138048509-138048531 GACCTCCACCCTAAGTATTCAGG + Intergenic
984024144 4:174522621-174522643 CACCTGCCCCCTGAGCGTTCTGG + Exonic
987078674 5:14406850-14406872 GACCTGAACCCTGAGGATTCAGG + Intronic
1000000859 5:157137362-157137384 GACCTACACCCAGAAGTTTCTGG + Intronic
1008999375 6:57695995-57696017 GACCTACACACTTTGGGTTCAGG - Intergenic
1009187863 6:60595400-60595422 GACCTACACACTTTGGGTTCAGG - Intergenic
1023165572 7:37340271-37340293 GACATACACACTGAGTGTTCAGG + Intronic
1032454207 7:132059540-132059562 GACTTGCACCCTGAGTGTTGTGG + Intergenic
1034353089 7:150429909-150429931 GACTTACTCTCTTAGCGTTCTGG - Intergenic
1040537750 8:48324333-48324355 GGCTTACTCCCTGAGCCTTCAGG + Intergenic
1049267235 8:141674769-141674791 GCCCCACACCATGAGTGTTCAGG - Intergenic
1050311634 9:4359168-4359190 GTCCCACACCCTAAACGTTCAGG + Intergenic
1061404631 9:130386502-130386524 GACCTTCACCCTCACCGTCCAGG + Intronic
1188674487 X:32922418-32922440 GACCTACCCCCTAAGCTTTAGGG + Intronic
1196908081 X:120458509-120458531 GAGAAACACCCTGAGGGTTCTGG + Intronic