ID: 1084121313

View in Genome Browser
Species Human (GRCh38)
Location 11:67070640-67070662
Sequence GACCTACACCCTGAGCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084121313_1084121316 9 Left 1084121313 11:67070640-67070662 CCAGAACGCTCAGGGTGTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1084121316 11:67070672-67070694 GTCGTCTTAGAGGCTGTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1084121313_1084121315 -1 Left 1084121313 11:67070640-67070662 CCAGAACGCTCAGGGTGTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1084121315 11:67070662-67070684 CAGAGCTGCGGTCGTCTTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084121313 Original CRISPR GACCTACACCCTGAGCGTTC TGG (reversed) Intronic