ID: 1084121315

View in Genome Browser
Species Human (GRCh38)
Location 11:67070662-67070684
Sequence CAGAGCTGCGGTCGTCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084121310_1084121315 7 Left 1084121310 11:67070632-67070654 CCAGGTGTCCAGAACGCTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1084121315 11:67070662-67070684 CAGAGCTGCGGTCGTCTTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 51
1084121306_1084121315 30 Left 1084121306 11:67070609-67070631 CCTCTGGATGCCTCTCAGTGGCA 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1084121315 11:67070662-67070684 CAGAGCTGCGGTCGTCTTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 51
1084121313_1084121315 -1 Left 1084121313 11:67070640-67070662 CCAGAACGCTCAGGGTGTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1084121315 11:67070662-67070684 CAGAGCTGCGGTCGTCTTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 51
1084121308_1084121315 20 Left 1084121308 11:67070619-67070641 CCTCTCAGTGGCACCAGGTGTCC 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1084121315 11:67070662-67070684 CAGAGCTGCGGTCGTCTTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084121315 Original CRISPR CAGAGCTGCGGTCGTCTTAG AGG Intronic
907892966 1:58653133-58653155 CAGAGCTGGGGTCTTTCTAGGGG + Intergenic
911557224 1:99359829-99359851 CTGAGCTGCAGTTGTCTTATGGG - Intergenic
912079077 1:105912748-105912770 CAGAACTGCTGTCTTCTTAGGGG + Intergenic
913680378 1:121184250-121184272 CAGAGCTGAAGTCGCTTTAGAGG + Exonic
914032213 1:143971901-143971923 CAGAGCTGAAGTCGCTTTAGAGG + Exonic
914157232 1:145096066-145096088 CAGAGCTGAAGTCGCTTTAGAGG - Exonic
917085089 1:171297011-171297033 CACAGCTGCTGGGGTCTTAGAGG + Intergenic
919861140 1:201740115-201740137 CAGAGCTGGGGTCGGGTTTGTGG + Intronic
920467690 1:206202785-206202807 CAGAGCTGAAGTCGCTTTAGAGG + Exonic
1064776812 10:18787924-18787946 CAGAGCTGGGGACTCCTTAGTGG - Intergenic
1070412492 10:76155592-76155614 CCCAGCTGAGGTCATCTTAGAGG + Intronic
1070916470 10:80158280-80158302 CAGAGGGGCGGGGGTCTTAGTGG + Intronic
1078065692 11:8077845-8077867 CAGGGCTGCAGTGGCCTTAGTGG - Intronic
1084121315 11:67070662-67070684 CAGAGCTGCGGTCGTCTTAGAGG + Intronic
1084668978 11:70594208-70594230 CAAAGCTGCGGTCCTTTTTGTGG - Intronic
1091829172 12:3537173-3537195 CAGAGCTGTGGTTGTTTTGGTGG + Intronic
1092118644 12:6027705-6027727 CAGGGCTGCATTCATCTTAGAGG - Intronic
1095411672 12:41932109-41932131 CAGAGCTGAGGTAGGATTAGAGG - Intergenic
1106848180 13:33760330-33760352 CAGATCAGAGGTCCTCTTAGGGG - Intergenic
1108847415 13:54694501-54694523 CAGAGCTGCTGTCTTCTAAGGGG - Intergenic
1118819040 14:69333172-69333194 CAGAGCTGCGGTGGGCTCTGGGG + Intronic
1119184373 14:72629563-72629585 CAGAGCTGGGGTCCTTTGAGGGG - Intronic
1119448483 14:74687212-74687234 CAGATTTGTGGTCTTCTTAGAGG + Intronic
1123794776 15:23760715-23760737 GAGGGCTGGGGTCGTCTGAGGGG + Intergenic
1126038678 15:44570428-44570450 CAGAGCTGATGTAGTCGTAGGGG - Intronic
1126359671 15:47833556-47833578 CAGGGCTGCTGTCTGCTTAGCGG - Intergenic
1128858121 15:71038406-71038428 CAGAGCTGCTGTTGTTATAGAGG + Intronic
1133440356 16:5816023-5816045 CAGAGCTGCTGTCCTTTTACTGG - Intergenic
1142478736 17:205131-205153 CAGAGCTTCGGCCGTCTTGGTGG + Intergenic
1142900601 17:3009091-3009113 CAGAGCTGCGGTTTTAATAGAGG - Intronic
1146914991 17:36672776-36672798 CAGAGCTGCTGTCCTCTTGAGGG + Intergenic
1152106185 17:78330477-78330499 CAGAGGTCAGGACGTCTTAGAGG - Intergenic
1153011431 18:543148-543170 CACAGGTGCAGTTGTCTTAGTGG - Intergenic
1161951857 19:7471874-7471896 CAGAGTTGAGGTCGTCGGAGGGG - Exonic
925879729 2:8342284-8342306 CAGAGCTGTGTTTCTCTTAGAGG - Intergenic
927690422 2:25204346-25204368 CAGAGCCGCGGACGGCTTTGGGG + Intergenic
934147802 2:89112628-89112650 CAGAGCTGCTGTCCTCCTGGGGG - Intergenic
934221471 2:90087980-90088002 CAGAGCTGCTGTCCTCCTGGGGG + Intergenic
941540039 2:166770773-166770795 CACAGCTAAGGTAGTCTTAGAGG + Intergenic
1174943519 20:54958570-54958592 CTGAGTTGCAGTCTTCTTAGTGG + Intergenic
1175608062 20:60327783-60327805 CAGAGCTGTGATCCTCTTGGAGG + Intergenic
1178645124 21:34378654-34378676 CAGAGCTGAAGTCTTCTTGGGGG + Intronic
1183605908 22:38866628-38866650 CAGAGCTGCGGGCGTCGTAGGGG + Exonic
1184099856 22:42336352-42336374 CAGAGCTGAGGTCATCCAAGGGG - Intronic
953381628 3:42476825-42476847 CAGAGCTCCGGATGTCTTAGAGG - Intergenic
962606800 3:137038840-137038862 CAGAGCTGTGTTCTTCTTAGAGG - Intergenic
974562599 4:63541236-63541258 CAGAGCTGCCCTCCTCTTAATGG + Intergenic
994617203 5:102118762-102118784 CAGAGCTGCTTTCGTTTTGGAGG - Intergenic
997783373 5:136682713-136682735 CAGAGCTGCGGTGGTAGTATAGG + Intergenic
1013616970 6:111852316-111852338 GAGAGCTGCAGTAGACTTAGAGG + Intronic
1018914729 6:168126018-168126040 CAGAGCTGCGTCCTTCCTAGAGG - Intergenic
1020995041 7:15252623-15252645 CAGAGCTGTGGTCGTATCTGAGG - Intronic
1022952622 7:35353030-35353052 CAGTGCTGCTGTCATCTTAAGGG - Intergenic
1023293273 7:38689195-38689217 CAGATCTGTGGTCTACTTAGTGG - Intergenic
1037579647 8:20236885-20236907 CAGAGCTGCGTCCCTCTTTGAGG + Intergenic
1056964541 9:91154980-91155002 CAGAGCTGCAGTAGGCTTAGGGG - Intergenic
1058718524 9:107742819-107742841 CAGAGCTGCGCTCATCTTCTGGG - Intergenic
1188226661 X:27607450-27607472 CAGAGCTTCAGTAGTCTCAGTGG + Intronic
1190777664 X:53566032-53566054 CAGAGCTGCTCTGGTGTTAGTGG - Intronic
1200988455 Y:9326962-9326984 CAGAGCTGTGGTGGTCTTGGTGG - Intergenic
1202119547 Y:21509230-21509252 CAGAGCTGTGGTGGTCTTGGTGG + Intergenic
1202121999 Y:21532770-21532792 CAGAGCTGTGGTGGTCTTGGTGG + Intronic
1202157007 Y:21896612-21896634 CAGAGCTGTGGTGGTCTTGGTGG - Intronic
1202159453 Y:21920153-21920175 CAGAGCTGTGGTGGTCTTGGTGG - Intergenic
1202185900 Y:22185068-22185090 CAGAGCTGTGGTGGTCTTGGTGG - Intergenic
1202205460 Y:22401328-22401350 CAGAGCTGTGGTGGTCTTGGTGG + Intronic