ID: 1084121316

View in Genome Browser
Species Human (GRCh38)
Location 11:67070672-67070694
Sequence GTCGTCTTAGAGGCTGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084121310_1084121316 17 Left 1084121310 11:67070632-67070654 CCAGGTGTCCAGAACGCTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1084121316 11:67070672-67070694 GTCGTCTTAGAGGCTGTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1084121308_1084121316 30 Left 1084121308 11:67070619-67070641 CCTCTCAGTGGCACCAGGTGTCC 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1084121316 11:67070672-67070694 GTCGTCTTAGAGGCTGTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1084121313_1084121316 9 Left 1084121313 11:67070640-67070662 CCAGAACGCTCAGGGTGTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1084121316 11:67070672-67070694 GTCGTCTTAGAGGCTGTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084121316 Original CRISPR GTCGTCTTAGAGGCTGTCAG AGG Intronic
902536873 1:17124266-17124288 GTTGTCTGAGGGGCTGCCAGGGG + Intergenic
911102598 1:94106095-94106117 CTGGCCTTAGAGGCTGTGAGAGG - Intronic
915510578 1:156384847-156384869 GTCCTCTCAGGGGCTGGCAGTGG - Exonic
915758768 1:158289925-158289947 ATCTTCTTAGTTGCTGTCAGCGG + Exonic
915758842 1:158290627-158290649 ATTGTCTTAGTTGCTGTCAGTGG + Intronic
918217987 1:182409844-182409866 TTAGTCTTAGAGACTGGCAGGGG - Intergenic
919937940 1:202267184-202267206 GTTGTCTTAGAGGATACCAGAGG + Intronic
1068989210 10:63133613-63133635 GTGGTCGCAGAGGCTGTGAGGGG + Intronic
1072007480 10:91267263-91267285 GTAGTTTTAGAGGAGGTCAGAGG - Intronic
1076220267 10:128728182-128728204 CTGTTCTCAGAGGCTGTCAGTGG - Intergenic
1076611364 10:131727810-131727832 GTCCTCCAAGAGGCAGTCAGAGG + Intergenic
1077004483 11:346309-346331 GTCATGTAAGATGCTGTCAGTGG - Intergenic
1078209024 11:9255154-9255176 GCCATCTTAGTGGCTGTAAGTGG - Intronic
1081988023 11:47321105-47321127 GTCGTCTAAGTGGCTGTTGGAGG - Intronic
1082758676 11:57104486-57104508 GGCATCTTAGAGGCTGGCTGTGG - Intergenic
1083136052 11:60677977-60677999 TGCGTTGTAGAGGCTGTCAGTGG + Intergenic
1084121316 11:67070672-67070694 GTCGTCTTAGAGGCTGTCAGAGG + Intronic
1089979745 11:122762498-122762520 GTTGTCTTCTAGGCTGTCAATGG - Intronic
1091889445 12:4041553-4041575 GTGGACTTAGGGGTTGTCAGTGG + Intergenic
1092770624 12:11893127-11893149 GTCATCTTAGAGGCTGAAATAGG - Exonic
1095739203 12:45588592-45588614 GTTGTCTTAGAGGCAGTATGGGG - Intergenic
1096203439 12:49702926-49702948 GTTGTCTAAGAGGCTTTGAGGGG - Intronic
1106576279 13:30978816-30978838 GTCATCTCTGAGGCTCTCAGTGG + Intergenic
1109247089 13:59967960-59967982 CTTGACTTAGAGGCTGGCAGAGG - Intronic
1110817032 13:79873045-79873067 GTGGACTGAGAGGGTGTCAGAGG - Intergenic
1114736424 14:25048688-25048710 TTCGTCTCAGAGGCTGCTAGTGG - Intronic
1116478564 14:45369521-45369543 GCTGTTTTGGAGGCTGTCAGGGG + Intergenic
1122296894 14:100710984-100711006 GTCTTCTCAGAGCCTGTCTGAGG + Intergenic
1123213643 14:106785313-106785335 GTCCTAGTAGAGGCTGTCTGTGG + Intergenic
1123400634 15:19981520-19981542 GCCCTAGTAGAGGCTGTCAGTGG + Intergenic
1126813932 15:52436300-52436322 GCCGGCTTAGAGGTTGGCAGGGG - Intronic
1133968036 16:10545949-10545971 CTGGTCCTAGAGCCTGTCAGGGG - Intronic
1135220835 16:20612805-20612827 GCTGTTTTAGAGGCTGTCTGGGG + Intronic
1141026241 16:80551520-80551542 GACAGCTTAGTGGCTGTCAGGGG - Intergenic
1143178915 17:4972416-4972438 GTCATCTCAGAGGCTGGCAGAGG + Exonic
1147364310 17:39950534-39950556 CTAGACTCAGAGGCTGTCAGAGG - Intergenic
1148224657 17:45890359-45890381 GCTGTCTTAGAGGCTGGAAGTGG - Intergenic
1148285517 17:46387549-46387571 GAGGTCTTAAAAGCTGTCAGAGG + Intergenic
1148307680 17:46605149-46605171 GAGGTCTTAAAAGCTGTCAGAGG + Intronic
1149643258 17:58218978-58219000 GGGTTCTTAGAGGCTGTGAGTGG + Intronic
1156371581 18:36476258-36476280 AGCGTCTCACAGGCTGTCAGAGG + Intronic
1158535916 18:58308371-58308393 GCCTTCTAAGAAGCTGTCAGTGG + Intronic
1161148445 19:2693894-2693916 CTCCTCTTGGAGGCTCTCAGAGG + Intronic
1161756539 19:6138237-6138259 GTCGTCTGAGACACAGTCAGTGG + Intronic
1161843684 19:6697609-6697631 GGCTTCTTGGAGGCTGCCAGGGG - Intronic
1165105775 19:33469010-33469032 GGCGTCATAGAGGGTGGCAGTGG - Intronic
1165553226 19:36605912-36605934 GTCGTGTTAGCTGCTGTCTGAGG + Intronic
1165929070 19:39344282-39344304 GTCTTCTGAGAGAGTGTCAGAGG - Intronic
932490462 2:72116593-72116615 GTCGTCTCAGAGGCTGTCTTGGG - Intergenic
935314553 2:101818733-101818755 GTTGCCTTGCAGGCTGTCAGAGG - Intronic
939289873 2:140180294-140180316 GGCCTCTAAGAGGCTGTGAGAGG - Intergenic
942178441 2:173356319-173356341 GCCGCCTTTGAGGCTGTCTGGGG + Intronic
1174606341 20:51764654-51764676 GTGGTCTTGGAGGTTGTGAGAGG - Intronic
1175216618 20:57394661-57394683 GTCGTCTTAGAGGGTGTTTGGGG + Intronic
1178602982 21:34011090-34011112 GCCTTCTTAGTGGCTGTCAAAGG - Intergenic
1185099018 22:48827785-48827807 GTGTTCTTAGAGGCACTCAGAGG - Intronic
950505309 3:13390974-13390996 GTCCTGTGAGAAGCTGTCAGAGG - Intronic
960417258 3:117399588-117399610 GTGGTCTGATAGGCTGTCTGTGG + Intergenic
961683903 3:128616864-128616886 TTTGTCTTGGAGGCTGTCATGGG - Intergenic
968729478 4:2262803-2262825 GGCGTCTCTGAGGGTGTCAGTGG + Intergenic
968910631 4:3475527-3475549 GTCCTCTCTGAGGCTTTCAGGGG + Intronic
975939400 4:79623896-79623918 GTTGTCTTGGAGGCTATCTGTGG + Intergenic
989027745 5:37086754-37086776 CTCTTCTTAGAGTCTGTAAGTGG + Intergenic
994038239 5:95227031-95227053 TTTGTCTAAGAGGCTGACAGAGG - Intronic
998499291 5:142618043-142618065 TTCTTTTTAGTGGCTGTCAGAGG + Intronic
999296615 5:150463559-150463581 TTCATCTGTGAGGCTGTCAGAGG + Intergenic
1009339459 6:62535559-62535581 ATCATCTTAGATGCTTTCAGAGG + Intergenic
1013845250 6:114443182-114443204 GTGGTTTTAGAGGATGTCATGGG + Intergenic
1020880935 7:13762767-13762789 GTCCTCTTGGAGGGTGTGAGAGG + Intergenic
1026146984 7:67755040-67755062 GTTCTCTTAGAGGTTGTCAAGGG - Intergenic
1031517455 7:122718749-122718771 GTCCTCTAAGAGGTAGTCAGTGG - Intronic
1034006238 7:147475073-147475095 GTCTTTTTAATGGCTGTCAGGGG + Intronic
1037646207 8:20795035-20795057 GTCCTCTTGGAATCTGTCAGGGG + Intergenic
1038145072 8:24887843-24887865 GACCTCTTAGAGGAGGTCAGTGG - Intergenic
1038891920 8:31734942-31734964 GTCATCTGTGATGCTGTCAGAGG + Intronic
1051209419 9:14726050-14726072 GTCTTCTGAGAGTCTGTAAGAGG - Intergenic
1051351141 9:16198883-16198905 GTGGCCTTAGAAGCTGTCATTGG - Intergenic
1053116905 9:35512498-35512520 GTTCTCTTTGAGGCTGTAAGTGG + Intronic
1059091314 9:111361584-111361606 GTCATCTCAGAGGCTTTCTGAGG - Exonic
1061072157 9:128317457-128317479 GTCTTCTTAGAGCCTCTCACTGG - Intronic
1202182072 Y:22148119-22148141 ATTGTCTTAGAGGCTGTCTGTGG + Intergenic
1202209288 Y:22438283-22438305 ATTGTCTTAGAGGCTGTCTGTGG - Intergenic