ID: 1084124967

View in Genome Browser
Species Human (GRCh38)
Location 11:67093479-67093501
Sequence TCCCAAGAGTAGGACCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084124962_1084124967 9 Left 1084124962 11:67093447-67093469 CCACCAGAAATTACAGTAGTAGT No data
Right 1084124967 11:67093479-67093501 TCCCAAGAGTAGGACCTGGCTGG No data
1084124963_1084124967 6 Left 1084124963 11:67093450-67093472 CCAGAAATTACAGTAGTAGTCAG No data
Right 1084124967 11:67093479-67093501 TCCCAAGAGTAGGACCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084124967 Original CRISPR TCCCAAGAGTAGGACCTGGC TGG Intergenic
No off target data available for this crispr