ID: 1084131703

View in Genome Browser
Species Human (GRCh38)
Location 11:67140820-67140842
Sequence TTAATTCACCAGTTATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 10, 3: 61, 4: 554}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084131702_1084131703 0 Left 1084131702 11:67140797-67140819 CCTTTCTGTCTCTAGTAGCATAT 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1084131703 11:67140820-67140842 TTAATTCACCAGTTATTTATTGG 0: 1
1: 0
2: 10
3: 61
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084131703 Original CRISPR TTAATTCACCAGTTATTTAT TGG Intronic
900734940 1:4293611-4293633 TTAACTCATCAACTATTTATTGG - Intergenic
901690411 1:10969592-10969614 TTCATTCAACAAATATTTATTGG + Intronic
902371233 1:16008339-16008361 TTTATTCACCAAGTATTTATTGG + Exonic
902692603 1:18119180-18119202 TTTATGCAGCAGATATTTATTGG + Intronic
902707822 1:18217973-18217995 TTCCTTCAACAATTATTTATTGG + Intronic
903988245 1:27245319-27245341 TTCATTCAGCAAATATTTATTGG + Intronic
904252565 1:29235718-29235740 TTCATTCAACAAATATTTATTGG - Intergenic
904390306 1:30180840-30180862 TTCATTCAGCAGATATTTTTTGG - Intergenic
905483744 1:38280877-38280899 TTGATTCAACAACTATTTATGGG + Intergenic
905616294 1:39402458-39402480 TCCATTCACCAAATATTTATTGG - Intronic
905818146 1:40967929-40967951 TTCATTTACCAAATATTTATTGG - Intergenic
906332480 1:44898451-44898473 TTTATTCAACAACTATTTATTGG - Intronic
906953426 1:50352304-50352326 TTCATTCATCAGTTATTTATTGG + Intergenic
907660713 1:56390207-56390229 TTTATTCAACAAATATTTATTGG - Intergenic
907740471 1:57160853-57160875 CTAATCAACCAGTTATTGATTGG - Intronic
907746284 1:57216962-57216984 TTCATTCAACAGCTATTTACTGG + Intronic
908776176 1:67642585-67642607 TTCATTCACCAAATATGTATTGG - Intergenic
908932032 1:69328561-69328583 TTATTTCATCAGTGGTTTATAGG + Intergenic
909003477 1:70247275-70247297 TTAATTCAACAGTCATTAAAAGG - Intronic
909267739 1:73582588-73582610 TTCATTCAATAGATATTTATTGG - Intergenic
909579718 1:77220776-77220798 TTAATTCAACAGATATCTATTGG + Intergenic
909586223 1:77291660-77291682 CTAATTCAACAAATATTTATTGG + Intronic
909620063 1:77657738-77657760 ATAATTTAACAATTATTTATTGG - Intronic
909772317 1:79439570-79439592 TTTATTCAGCAAATATTTATTGG - Intergenic
910039678 1:82834570-82834592 TTCATTCAACAGATATTTAATGG + Intergenic
911211345 1:95141697-95141719 TTAATTCAACATATGTTTATTGG - Intronic
911695075 1:100881756-100881778 TTAATTCATTAGTTCTTTATAGG + Intronic
912529926 1:110312848-110312870 TTAATTCAGCAAATATTTACAGG - Intergenic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
913109667 1:115646656-115646678 TTCATTCAGCAGACATTTATAGG + Intronic
914949142 1:152096358-152096380 TTCATTCAACAGTTATTTCTTGG - Intergenic
914959109 1:152190241-152190263 TTCATTCAACAAATATTTATTGG + Intergenic
915078587 1:153334327-153334349 TAAATACACCTGTTATATATAGG + Intronic
915620270 1:157078298-157078320 TTAATTCAACAAGTATTTATGGG - Intergenic
915702974 1:157813248-157813270 ATAAATCTCCAGTTAGTTATTGG - Intronic
916545110 1:165796765-165796787 TTAATTCAACAAGTATGTATGGG + Intronic
916778475 1:167995822-167995844 TTAACTCACCAAATATTTATTGG + Intronic
917147498 1:171908153-171908175 TTATTTCACAACTCATTTATTGG + Intronic
917165714 1:172110480-172110502 TTCATTCAACAGTTACTTGTTGG - Intronic
917644332 1:177015266-177015288 TTATTTCACCAAATATTTCTAGG + Intronic
917948332 1:180001101-180001123 TTAATTGTGCAGTTATGTATGGG + Intronic
918509843 1:185299486-185299508 TTAATTCACCAGTCTTTTGATGG - Intronic
918618010 1:186570489-186570511 TTATTTCACTAATTATTTGTAGG + Intergenic
919047086 1:192465895-192465917 TTAATTCAACAAATATTTGTTGG + Intergenic
919290324 1:195622053-195622075 TTAATTATTCAGTTATTTAAAGG + Intergenic
919340148 1:196295184-196295206 TTAATTGACAAATTATTAATTGG - Intronic
919692996 1:200544211-200544233 TTTATTCAACAGGTATTTACTGG + Intergenic
921048652 1:211495197-211495219 TTCATTCACCAAGCATTTATTGG + Intergenic
921233934 1:213104211-213104233 TGAATGTACCATTTATTTATCGG + Intronic
922306206 1:224346991-224347013 TTAATTGACCATATATTTGTGGG + Intergenic
923291752 1:232552668-232552690 TTGATTCAACAGATACTTATTGG - Intronic
924072915 1:240300289-240300311 TTCATTCAACAGTCATTTAATGG - Intronic
924304789 1:242676466-242676488 ATAATTCATCACTTCTTTATGGG + Intergenic
1063837033 10:10027159-10027181 TTAATTCAGCAAATATTTGTTGG + Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1066188689 10:33035988-33036010 TTATTTCACCATTTAATTGTTGG + Intergenic
1068882700 10:62066992-62067014 TTAATTCACCAAAAATTTATTGG - Intronic
1070970975 10:80566947-80566969 GTAATTCTCCAGATATATATAGG - Intronic
1071117139 10:82234575-82234597 TTCATTCAACAATTATTTATTGG - Intronic
1071847996 10:89539419-89539441 TTAACACACGTGTTATTTATTGG - Intronic
1072794281 10:98342558-98342580 TCAATTCAACAAATATTTATTGG - Intergenic
1073888939 10:108074708-108074730 TAAATTCACGAATTATTTCTGGG + Intergenic
1074065590 10:110009547-110009569 ATAATGTTCCAGTTATTTATAGG - Intronic
1074444423 10:113507604-113507626 TCAATTCACCAGAGATGTATGGG + Intergenic
1075277993 10:121112730-121112752 TTAATTCAACAAATATTTACTGG + Intergenic
1075380066 10:122011801-122011823 TTAATTGAACAAATATTTATTGG + Intronic
1076517333 10:131054374-131054396 TAACCTCACCAGATATTTATGGG - Intergenic
1076557396 10:131336206-131336228 TTAATACACCAGTGGTTTCTTGG - Intergenic
1077203229 11:1324774-1324796 TGAATTCATCAAATATTTATTGG - Intergenic
1077786271 11:5387332-5387354 TAAATTCACCAGTGACTTCTAGG - Intronic
1078114371 11:8430771-8430793 ATAATTCAACAAATATTTATTGG - Intronic
1078819188 11:14859752-14859774 TTCATTCAACAAGTATTTATTGG + Intronic
1079937006 11:26629604-26629626 TTAATTCAACAGTTTATTAAAGG - Intronic
1080000611 11:27345033-27345055 TCAATTGACCACATATTTATAGG - Intronic
1080050795 11:27856932-27856954 TTCATTCAACAAATATTTATTGG - Intergenic
1080072333 11:28104762-28104784 TTTATTCAACAAGTATTTATTGG - Intronic
1080074002 11:28126478-28126500 TTATTTCAACAAATATTTATGGG - Intronic
1080112630 11:28585532-28585554 TCCATTCAATAGTTATTTATTGG + Intergenic
1083279298 11:61616481-61616503 ATAATTCACATGTAATTTATGGG + Intergenic
1083982974 11:66189401-66189423 TTTATTCAACAAATATTTATTGG + Intronic
1084131703 11:67140820-67140842 TTAATTCACCAGTTATTTATTGG + Intronic
1086202163 11:84217075-84217097 TTCATTGACCAGTTAGTTTTAGG - Intronic
1086237266 11:84646232-84646254 TTAAATAACCTGTTTTTTATGGG - Intronic
1086598970 11:88608884-88608906 TTCATTCACCAAATATTTATTGG - Intronic
1087124235 11:94607261-94607283 TTAATTCACCAGTGTTTTAATGG + Intronic
1087228894 11:95637241-95637263 TTTATTCACTTATTATTTATGGG + Intergenic
1087594706 11:100238040-100238062 GTAATTCTCAGGTTATTTATGGG + Intronic
1087904476 11:103679842-103679864 TTAATTAATCAAATATTTATTGG + Intergenic
1088059297 11:105626916-105626938 TTAAAGCACGAGTTATTTAGAGG + Intronic
1088273614 11:108060907-108060929 TTCATTCAACAGGTACTTATTGG + Intronic
1088558237 11:111085150-111085172 TTAATTGATTAGTTTTTTATGGG - Intergenic
1088558880 11:111092015-111092037 TCTATTCAACAGTTATTTGTTGG - Intergenic
1089449349 11:118581651-118581673 TTTATTCAGCAGACATTTATTGG + Intronic
1089977515 11:122745351-122745373 TTCATTCAGCAAGTATTTATGGG + Intronic
1090265833 11:125352278-125352300 TGAATTCAATAATTATTTATTGG + Intronic
1090310380 11:125731420-125731442 TTAATTGTCAAGTTATTTTTTGG - Intergenic
1090642640 11:128742335-128742357 TTAATTTAGCAAATATTTATTGG - Intronic
1091393556 12:140122-140144 TTCATTCGGCTGTTATTTATTGG + Intronic
1092098715 12:5865197-5865219 TCAATTCAACAAGTATTTATTGG + Intronic
1093495819 12:19756117-19756139 TTTATTTACTTGTTATTTATAGG + Intergenic
1093530607 12:20157826-20157848 TTCATTCAACAAATATTTATTGG - Intergenic
1093907615 12:24711602-24711624 TTCATTCACCAGACACTTATTGG - Intergenic
1095179282 12:39128475-39128497 TAAATACACCAGTGATTTATTGG - Intergenic
1095486877 12:42694589-42694611 TTAATTCATTTGGTATTTATTGG + Intergenic
1095614861 12:44176327-44176349 TTCATTCCACAGGTATTTATTGG - Intronic
1095682038 12:44988592-44988614 TTATTTCAACAGGTTTTTATTGG - Intergenic
1095853808 12:46839175-46839197 CTGATACAACAGTTATTTATTGG + Intergenic
1096162416 12:49390054-49390076 GTGATTCTCGAGTTATTTATAGG - Intronic
1096243347 12:49971194-49971216 TTCATTCAACAAATATTTATTGG + Intronic
1097415946 12:59316990-59317012 ATATTTCAACAGTTTTTTATGGG + Intergenic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1098027992 12:66225599-66225621 TTAATTCAAAAATTACTTATGGG - Intronic
1099445444 12:82746409-82746431 TTAATTGAACACATATTTATGGG + Intronic
1099787025 12:87278313-87278335 TTAATTCCTCAGTTAATTAAAGG - Intergenic
1100924640 12:99530839-99530861 TTTATTCAACAAATATTTATTGG - Intronic
1101216941 12:102594817-102594839 CAAATTCACCAGGTATTTGTTGG + Intergenic
1101315860 12:103628193-103628215 TTAATTCTTCAGTTATTTGAGGG + Intronic
1101624988 12:106431134-106431156 TTAATTCAGCATATATTCATGGG - Intronic
1101752042 12:107589815-107589837 TTCATTCAACAATTATTTATTGG - Intronic
1101931924 12:109021727-109021749 TTTATTCAACAAATATTTATGGG - Intergenic
1104264964 12:127223293-127223315 TTTATTCCCCAGTCATTTGTGGG - Intergenic
1104548660 12:129735359-129735381 TTTATTCAACAATTATATATTGG - Intronic
1105458653 13:20564268-20564290 TTAATTCAACAAATATTTCTTGG + Intergenic
1106058261 13:26259784-26259806 TTCATTCAACAAGTATTTATTGG + Intronic
1107852885 13:44588585-44588607 TTAATCCACCAATTACATATAGG + Intergenic
1108123291 13:47212941-47212963 TTAAGCCACAAGGTATTTATAGG - Intergenic
1108961232 13:56232933-56232955 TTAAATCAACTATTATTTATAGG + Intergenic
1109580185 13:64320649-64320671 TTCATTTAGCAGATATTTATTGG - Intergenic
1109663747 13:65501612-65501634 TTTGTTCACCACTTATTCATTGG - Intergenic
1109735187 13:66474454-66474476 TTAATTTGGCAGATATTTATTGG - Intronic
1110081853 13:71323284-71323306 TCAATTCAACACATATTTATTGG - Intergenic
1111433006 13:88168142-88168164 TTAATGCGCCAGTTATTAAATGG + Intergenic
1111632526 13:90860651-90860673 TCAAATCACCAATTATTTACTGG + Intergenic
1111835304 13:93380857-93380879 TTCAATCAGCAGGTATTTATTGG + Intronic
1111918450 13:94385705-94385727 TTAATTCAGCAAGTCTTTATTGG - Intronic
1111954216 13:94739484-94739506 TTAATTCAACAAATATTTCTAGG + Intergenic
1112752234 13:102595069-102595091 TTCATTCCCCATTTATTCATTGG + Intergenic
1113646761 13:112002995-112003017 TTAATATACCAGTTATTTCTAGG - Intergenic
1114660611 14:24341289-24341311 TCAATTCAACAAATATTTATTGG - Intergenic
1114859941 14:26504739-26504761 TTCATTCAGCAGTTACGTATTGG - Intronic
1114893381 14:26954081-26954103 TTAATGCTCCAGATGTTTATAGG - Intergenic
1115449913 14:33535584-33535606 TTAATTCATTAGGTATTTATTGG - Intronic
1115812060 14:37120462-37120484 TAAAGTCACCACTGATTTATTGG - Intronic
1115813720 14:37139212-37139234 TTAAATCCCCAGTGATATATTGG - Intronic
1115972092 14:38956115-38956137 TTGATTCAACATGTATTTATTGG - Intergenic
1116328589 14:43566892-43566914 TTAATTCAGCATGTAATTATAGG - Intergenic
1116861733 14:50000981-50001003 TTAATTATCCAGTTAGTCATAGG + Intronic
1117088384 14:52224504-52224526 CTAATTTTCCAGTTATTTGTGGG - Intergenic
1117391089 14:55263632-55263654 TTAATTCAACAGATATTTATTGG + Intergenic
1117491180 14:56249513-56249535 TTAATTCAACGGATATTTCTGGG + Intronic
1117556419 14:56890158-56890180 TTAATACACTAGTTATTTCAGGG + Intergenic
1119341359 14:73881575-73881597 TTAATTTAACAAATATTTATGGG + Intronic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1120773239 14:88404822-88404844 TTTATTCAGCATATATTTATTGG + Intronic
1121625722 14:95384304-95384326 TGGAGTCTCCAGTTATTTATTGG - Intergenic
1121781721 14:96626291-96626313 CTCATTCAGCAGATATTTATTGG + Intergenic
1122005829 14:98702847-98702869 TTAATTAATTATTTATTTATTGG - Intergenic
1124550511 15:30676633-30676655 TTCATTCAGCAGATATTTGTGGG - Intronic
1124681333 15:31733668-31733690 TTTATTCAGCAGATATTTGTCGG - Intronic
1125184709 15:36916948-36916970 TAAATTCACCAGTTAGTAAGTGG + Intronic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125189150 15:36969504-36969526 TTAATTCTTTAGTTATTTAAAGG + Intronic
1125410469 15:39400695-39400717 TTGAATCAACAATTATTTATTGG - Intergenic
1125616014 15:41013960-41013982 ATAATCCAACAGTTATTTTTGGG - Intronic
1125882410 15:43206158-43206180 TTCATTCAACACATATTTATTGG - Intronic
1126210587 15:46097259-46097281 TTAATTTACTATTTATTTGTGGG + Intergenic
1126703822 15:51389293-51389315 CTCATTCATCAATTATTTATTGG - Intronic
1127318338 15:57818159-57818181 TTAACTCAACAGTTGTCTATTGG - Intergenic
1127407690 15:58668783-58668805 TAAATTCAACAAGTATTTATTGG - Intronic
1127536412 15:59893895-59893917 TTAATTCAACAACTATTTACAGG + Intergenic
1127861609 15:62998390-62998412 TTAAGTCAACAGGTATTTACTGG + Intergenic
1128101182 15:65001342-65001364 TTAATTCAACATTTATGGATAGG - Intergenic
1129481341 15:75828933-75828955 TTCATTCACCAAATATTTGTTGG + Intergenic
1129766364 15:78171612-78171634 TTAATTCCTGAGTTATATATAGG - Exonic
1129820895 15:78601196-78601218 TTCATTCAACAAATATTTATGGG - Intronic
1130527342 15:84718629-84718651 TAAATTCAACAAGTATTTATTGG - Intergenic
1132191848 15:99869832-99869854 ATAATTCACCAATTTTTTTTAGG - Intergenic
1132310977 15:100857937-100857959 TTCATTCACCACTTTTTGATGGG + Intergenic
1133593916 16:7272535-7272557 TTCATTCATCAAATATTTATAGG + Intronic
1135078171 16:19411785-19411807 TTCATTCAACAAGTATTTATAGG - Intronic
1135165143 16:20132501-20132523 TTCATCCAACAGATATTTATTGG + Intergenic
1135671089 16:24376192-24376214 TTAATTCAGCAACTGTTTATTGG + Intergenic
1135701417 16:24635972-24635994 TTAATTCATTACATATTTATTGG + Intergenic
1136045098 16:27609223-27609245 TTATTACACCTTTTATTTATTGG - Intronic
1137978367 16:53049734-53049756 TTAATTCACCAGTCATTGATGGG + Intergenic
1138043104 16:53695877-53695899 TTAAACCAAAAGTTATTTATAGG + Intronic
1138777497 16:59741494-59741516 TTCATTCATCAGATATTTACTGG - Intronic
1138787833 16:59867566-59867588 TTTATTCACCAATTACTAATTGG - Intergenic
1138788447 16:59873300-59873322 TTTATTCACCAATTACTAATTGG - Intergenic
1139604950 16:68011540-68011562 TTTATTCAACAAGTATTTATTGG - Intronic
1139996901 16:70989800-70989822 TTAATTCAGCTGATATTTACTGG + Intronic
1140301053 16:73757529-73757551 TTAATTCAGTAAATATTTATTGG + Intergenic
1140594271 16:76390559-76390581 TTTTTTTACCTGTTATTTATGGG - Intronic
1141356795 16:83354380-83354402 TTCATTCAACAAGTATTTATCGG + Intronic
1142774216 17:2123503-2123525 TTAATTCATCAGTTAGGGATTGG - Intronic
1143706430 17:8700817-8700839 TTCATTCAACAAATATTTATGGG - Intergenic
1144236092 17:13262121-13262143 TTTATTCAAAAGTTCTTTATAGG - Intergenic
1144587795 17:16498527-16498549 TTCATTCAGCAAGTATTTATGGG - Intergenic
1145197905 17:20911367-20911389 TAAATTCATCAGACATTTATTGG - Intergenic
1145855987 17:28157901-28157923 TTCATTCATCAAATATTTATAGG + Intronic
1146478101 17:33179308-33179330 TTAATTTAACAGTTATTTTGTGG - Intronic
1147346443 17:39799246-39799268 TTCATACACCAGGAATTTATGGG - Intronic
1147600069 17:41739918-41739940 TTCATTCAACAAATATTTATTGG - Intergenic
1147618200 17:41843734-41843756 TTTATTTACTATTTATTTATGGG - Intronic
1147785347 17:42974470-42974492 TTCATTCAAAAGATATTTATTGG + Intronic
1148522328 17:48290736-48290758 TTTATTCAACAGATATTTACTGG - Intronic
1149118239 17:53126526-53126548 CTAAATCACCAGCTATTTATTGG - Intergenic
1149306713 17:55354872-55354894 TAAATTCAGCAAATATTTATTGG - Intergenic
1149310424 17:55387646-55387668 TTCATTCAACAGATGTTTATTGG - Intergenic
1151069607 17:71193714-71193736 TTCATTCAACAAATATTTATTGG + Intergenic
1151151327 17:72090056-72090078 TTCATTCAACAAATATTTATCGG - Intergenic
1153091683 18:1353765-1353787 TAAATTCAACACTCATTTATTGG + Intergenic
1153332858 18:3891571-3891593 TTTATTCACTTGATATTTATTGG - Intronic
1155315901 18:24569769-24569791 TTCATTCAACAGGTATTTGTTGG - Intergenic
1155351405 18:24911226-24911248 TTCATTCAGTTGTTATTTATTGG + Intergenic
1156701492 18:39830836-39830858 TTTATTCACCAAATATTTATTGG - Intergenic
1157099349 18:44715383-44715405 TTAATCCAGAAGTTATTTACAGG + Intronic
1158167448 18:54556414-54556436 TTAATTCAAGAAATATTTATTGG - Intergenic
1158376705 18:56878490-56878512 TTAATTTAACAAATATTTATTGG - Intronic
1159856375 18:73594513-73594535 TTCAATCACCATATATTTATTGG - Intergenic
1161433848 19:4250294-4250316 TTCATTCAACACTCATTTATTGG + Intronic
1161856792 19:6770481-6770503 TTCATTCAACAGGTATTTAAGGG + Intergenic
1163174368 19:15553824-15553846 TTAATTTACCAAATATTTCTTGG + Intergenic
1164450662 19:28361126-28361148 TTTATTCATCTATTATTTATTGG - Intergenic
1165501312 19:36191757-36191779 TTCCTTCACCATTTATTAATTGG - Intronic
1165789842 19:38484669-38484691 TTCATTCAACAAATATTTATGGG + Intronic
1167039647 19:47015480-47015502 TTCATTCAACAAATATTTATCGG - Intergenic
1167474780 19:49693552-49693574 TTCATTCACCATATATTTATGGG + Intronic
1168285635 19:55331151-55331173 TTACTTCACCTGGTTTTTATGGG + Intronic
1168596132 19:57679118-57679140 TTTATTCAACAGAAATTTATTGG - Exonic
925156524 2:1652450-1652472 TTATTTCAACAAGTATTTATTGG - Intronic
925742037 2:7014269-7014291 TTCATTCAACAACTATTTATGGG - Intronic
925831313 2:7898630-7898652 GTAATTAACCAATTATTGATGGG - Intergenic
926346311 2:11949018-11949040 TCAATTCACCATTTATGTGTGGG - Intergenic
926583303 2:14656111-14656133 ATAATTCACTATGTATTTATTGG - Intergenic
927803152 2:26120055-26120077 TTCATTGATCATTTATTTATTGG + Intronic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928237684 2:29558855-29558877 TCAATTCAGGAGTCATTTATGGG - Intronic
928276600 2:29906390-29906412 TTAATTCAACAAATAATTATTGG - Intronic
928322994 2:30298025-30298047 TTAATTTAAGAGCTATTTATGGG - Intronic
929368509 2:41192161-41192183 TTCATTCAACAACTATTTATTGG - Intergenic
929408751 2:41672690-41672712 ATAATTCAGAAGTTATTTAGAGG + Intergenic
929575096 2:43046483-43046505 TTCATTCAACAGTTATTTACTGG + Intergenic
930147564 2:48023047-48023069 TTAATTCACCACTCATTCCTGGG - Intergenic
930326394 2:49924900-49924922 TTAATTAATCAGTTAGATATTGG - Intronic
930328843 2:49956810-49956832 TTAAATCAACAGTTATATACAGG - Intronic
931009964 2:57899456-57899478 TAAATTCAGCAGGTATTTATTGG + Intergenic
931680477 2:64743361-64743383 TTAATTCAACAGATATTTATTGG - Intronic
931870623 2:66455509-66455531 TTGATTCACTTGTAATTTATTGG + Intronic
931896910 2:66742601-66742623 CTAATTCACCAGATATCTCTTGG - Intergenic
932030449 2:68178263-68178285 TTAATTTATTAATTATTTATTGG + Intronic
932843929 2:75115556-75115578 TTATTTAACCAATCATTTATTGG - Intronic
933420013 2:82032849-82032871 TATTTTCACCAGTTATTTTTTGG + Intergenic
933425300 2:82103652-82103674 GTAATTCTCCAGTTTTCTATTGG - Intergenic
933938274 2:87224754-87224776 TTTATTCACAAACTATTTATTGG - Intergenic
934909906 2:98242193-98242215 TTCATTCATCACTTATGTATGGG + Intronic
935094502 2:99931543-99931565 TTAAAACAACAGTTATTGATAGG + Intronic
936763521 2:115816068-115816090 TTAATTCAGTAACTATTTATTGG + Intronic
936842056 2:116781971-116781993 TTAATTCAGCAATTAGTTTTAGG - Intergenic
937755467 2:125532318-125532340 TCAATTAAGCAGTTATTTCTGGG - Intergenic
937778223 2:125806701-125806723 TTAATTTACCAGTTTTCTAATGG + Intergenic
938691725 2:133797292-133797314 TTAATTGACCATATATGTATGGG + Intergenic
939468571 2:142590032-142590054 TTAATTCACCACTAGTTTCTGGG + Intergenic
939545591 2:143548637-143548659 TTAATTTCCCAGGTATTTGTAGG - Intronic
939680995 2:145131852-145131874 TTAATTAACAACTTATTAATTGG + Intergenic
939819825 2:146944176-146944198 TTTATTCAACAAGTATTTATTGG + Intergenic
939865622 2:147469338-147469360 TTTATTCTGCAGTTGTTTATGGG - Intergenic
940551646 2:155165900-155165922 TCATTTCTCCAGTTATTTCTGGG - Intergenic
941822201 2:169855199-169855221 CTAAATCACCATTTAATTATTGG + Intronic
942216357 2:173723175-173723197 ATAGTTCAACATTTATTTATGGG - Intergenic
942351062 2:175053369-175053391 TTAATTCAACATCTATTTTTTGG - Intergenic
942538807 2:176994207-176994229 TTGATTCAACAAATATTTATTGG + Intergenic
942562271 2:177233063-177233085 TTAATTGTAAAGTTATTTATAGG + Intronic
943127274 2:183810276-183810298 ATAATTTACCAGTGATTTAATGG - Intergenic
943567129 2:189529329-189529351 TTCATTCAACAAATATTTATTGG + Intergenic
943567657 2:189535538-189535560 TTCATTCAACATATATTTATTGG + Intergenic
943595817 2:189854491-189854513 TTAAATCACCAGATAAGTATTGG + Exonic
943921993 2:193719821-193719843 TTATTTAAATAGTTATTTATTGG + Intergenic
944948743 2:204722009-204722031 TTTTTTCACCACTTATTCATTGG - Intronic
945723168 2:213444410-213444432 CTAAGTAAACAGTTATTTATAGG - Intronic
945760293 2:213905549-213905571 TTGATTCAACAGCTGTTTATTGG + Intronic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
947366422 2:229400678-229400700 TTATTTAATCATTTATTTATGGG - Intronic
947489640 2:230582442-230582464 TTCATTCATCAGTTAATGATGGG - Intergenic
947817948 2:233050662-233050684 TTAATTCAACACATGTTTATTGG + Intergenic
1168737512 20:154940-154962 TTAATTCGCTAGTTGTTTAGTGG - Intergenic
1169282948 20:4282477-4282499 TTAATTAACCAGTTCTCTACAGG + Intergenic
1169650066 20:7857176-7857198 TTAACTCAACAAATATTTATTGG - Intergenic
1170074198 20:12401874-12401896 TTTATCCACCAATTATTTACTGG + Intergenic
1170187584 20:13608401-13608423 TTAATTCAACAAATATTTATTGG + Intronic
1171288438 20:23964424-23964446 CTAATTCAACAGTTATCTAAAGG - Intergenic
1171383899 20:24754143-24754165 TTAAATAATCATTTATTTATTGG - Intergenic
1171997204 20:31740862-31740884 TCAATTCAACAGGTATTTAGTGG - Intronic
1172064358 20:32208391-32208413 TTGATTCAGCAAATATTTATGGG + Intronic
1172379028 20:34473088-34473110 TTTATTAACCAGTTATTTGATGG - Intronic
1173059730 20:39650166-39650188 TTAAATCAACAAATATTTATTGG + Intergenic
1173147420 20:40536803-40536825 TTTATTCATCAAATATTTATTGG + Intergenic
1173347755 20:42216382-42216404 TTAATTCAACAGGTCTTTACAGG - Intronic
1173359189 20:42324983-42325005 TTTATTCATCAGACATTTATTGG + Intronic
1173391487 20:42638879-42638901 TTAATTCTCCATTAATTCATGGG - Intronic
1174215882 20:48915850-48915872 TTAAATCAGCAGTTATTTGGAGG - Intergenic
1174414095 20:50355858-50355880 TTAATTCAGCAGATATTTTATGG + Intergenic
1174699688 20:52595488-52595510 TCAATTGACTAGTTATTAATTGG - Intergenic
1175268616 20:57717982-57718004 TTCATTCAGCAAATATTTATTGG - Intergenic
1177217897 21:18153015-18153037 ATAATTAACCAGTTATGTCTAGG - Intronic
1177308671 21:19356172-19356194 TTAATTCACCTGTTTTTAATTGG + Intergenic
1177465904 21:21479923-21479945 TTAATTTAAGAATTATTTATTGG + Intronic
1177497789 21:21911487-21911509 TTAATTCACCAATGAGTTTTTGG - Intergenic
1179302501 21:40124916-40124938 TTAATTCTCCAGTTATCCAGAGG - Intronic
1181527494 22:23498600-23498622 TTTATTCAACAATTATTCATTGG - Intergenic
1181816708 22:25442974-25442996 TTAATTAAACAATTATGTATGGG + Intergenic
1182249520 22:28989091-28989113 TTCACTCACCAAATATTTATTGG + Intronic
1182954990 22:34415751-34415773 TTCATTCAAAAGGTATTTATTGG + Intergenic
1182972724 22:34592994-34593016 CTAATTCAATAGATATTTATTGG + Intergenic
1183272182 22:36869102-36869124 TTAACTCACAAGTTATTGAGGGG - Intronic
1183867735 22:40717384-40717406 TTAATTTACCTGTTAGCTATTGG + Intergenic
1184433141 22:44453471-44453493 TTCATCCATCAGTTATTCATTGG + Intergenic
949216062 3:1568499-1568521 TTTATTCAACAAATATTTATTGG - Intergenic
949341344 3:3034292-3034314 TTAATTCATTATTTATTTATAGG - Intronic
949978034 3:9478393-9478415 TTCATTCAGCAACTATTTATTGG + Intronic
950999402 3:17540377-17540399 TTTATTCGGCAGTTATTTATTGG - Intronic
951772429 3:26273451-26273473 TTCATTCATCAAGTATTTATTGG + Intergenic
952277969 3:31895827-31895849 TAAATTCTACAGTTATTTGTGGG + Intronic
952916112 3:38244044-38244066 TTAAAACAACAGTTGTTTATTGG - Intronic
952961837 3:38597124-38597146 TGAATTCAACAAATATTTATTGG + Intronic
953436001 3:42877644-42877666 TCCATTCACTAGATATTTATTGG + Intronic
954243075 3:49309390-49309412 TTAATTCATCAAATATTTATTGG - Intronic
954549365 3:51467744-51467766 TTAATTCAACAGTGCTGTATAGG - Intronic
955607393 3:60720362-60720384 TTTATTCAACAAATATTTATGGG - Intronic
955821684 3:62902426-62902448 TTGATTCAACATATATTTATGGG + Intergenic
956687522 3:71843981-71844003 TTGATTCACCAATAATTGATAGG - Intergenic
956813488 3:72887652-72887674 TTTATTCAACAGATATTTATTGG + Intergenic
957001811 3:74895293-74895315 TTATTTTACCAGCTATTTTTTGG + Intergenic
958049535 3:88327530-88327552 TTAATCAAGAAGTTATTTATTGG + Intergenic
958622518 3:96579872-96579894 ATAACTCACCAGTATTTTATAGG + Intergenic
959018316 3:101161096-101161118 TTTATTCTCCTATTATTTATTGG - Intergenic
959123358 3:102259715-102259737 TTATTTAACCAGTTCTGTATTGG + Intronic
959693794 3:109227669-109227691 TTCATTTAGCAGATATTTATTGG + Intergenic
960061638 3:113328996-113329018 TTAATTTAGCAAATATTTATTGG - Intronic
960458507 3:117903274-117903296 TTCATTCAACAAATATTTATAGG - Intergenic
960692208 3:120358563-120358585 TTAATTCAACAAATACTTATTGG + Intergenic
961099256 3:124184800-124184822 TTAATTCAACAATCATTTATTGG - Intronic
962514553 3:136138230-136138252 TTATTTCAACAGATATTTACTGG + Intronic
962650278 3:137481505-137481527 GAAATTCACCAGATATATATTGG - Intergenic
962911682 3:139857266-139857288 TTAATTCACAGATTATTTAGAGG + Intergenic
963389769 3:144645815-144645837 GTAATTAATAAGTTATTTATGGG - Intergenic
963609696 3:147451758-147451780 TTATTTCACCAGTTACTAAGAGG + Intronic
963658805 3:148096319-148096341 TTAATTCACCAGATAGTTGATGG - Intergenic
964449081 3:156792777-156792799 TTCATTCAACAAATATTTATTGG + Intergenic
965047281 3:163595721-163595743 TTTCTTCCCTAGTTATTTATTGG + Intergenic
966004987 3:174999508-174999530 TAAATCCATCAGTTATTCATAGG + Intronic
966083920 3:176043382-176043404 TTAATTCAACAGATCTTTGTGGG - Intergenic
966220577 3:177547317-177547339 TTCATTCACCAAATAGTTATGGG - Intergenic
966639311 3:182171823-182171845 TTAAATCACCATTTAAATATTGG + Intergenic
967190783 3:186983170-186983192 TTCATTCACCAAATATTTACTGG + Intronic
967817326 3:193810477-193810499 ATTCTTCACCACTTATTTATAGG + Intergenic
968263748 3:197346064-197346086 TTACTTAACCACTTCTTTATTGG + Intergenic
969629112 4:8325174-8325196 TTCATTCAACAAATATTTATTGG - Intergenic
969722855 4:8902637-8902659 GTAATTCACAAGTAATTTGTAGG + Intergenic
969993366 4:11287298-11287320 TTCATTCAGCAGAGATTTATTGG - Intergenic
969997267 4:11325749-11325771 TTTATTCAACAAATATTTATTGG + Intergenic
970504119 4:16709549-16709571 TTAACTCACAAGATATTTGTAGG + Intronic
971302778 4:25455763-25455785 TTCATTCAACAGATATATATTGG + Intergenic
971348816 4:25838059-25838081 TTCATTCATCAAATATTTATGGG - Intronic
971747237 4:30598774-30598796 TTAATTTTGCATTTATTTATGGG - Intergenic
971832050 4:31707106-31707128 TTAATTCAACAAATATGTATTGG - Intergenic
971975834 4:33685217-33685239 TTAATTTATCAGATATGTATAGG - Intergenic
972165514 4:36279299-36279321 TTCATTTACCACTTATTTACTGG + Intergenic
972209010 4:36814436-36814458 TTCATTCAGCAAATATTTATGGG - Intergenic
973577434 4:52304453-52304475 TTCATTCAACAGATATTGATTGG + Intergenic
973930412 4:55787894-55787916 ATATTTCAACAGTGATTTATAGG - Intergenic
974245682 4:59314298-59314320 TTAATTCACCATATTGTTATGGG + Intergenic
974667738 4:64986900-64986922 TTACTTGACCTGTTGTTTATTGG - Intergenic
974671809 4:65040570-65040592 TTTATTCACCAGTTAATTATTGG + Intergenic
974708569 4:65557444-65557466 TTGATTCAGCAAATATTTATAGG + Intronic
974724025 4:65776431-65776453 TTAATTCAACATATAGTTATTGG - Intergenic
975425490 4:74221887-74221909 TTAATTCTCTATTTATTTATAGG + Intronic
975544869 4:75550118-75550140 TTCATTCAACAACTATTTATTGG - Intronic
976010639 4:80484111-80484133 TTATTTCACCAGCTCTTTAGGGG - Intronic
976034948 4:80806471-80806493 TTCATTCAGCAAATATTTATTGG + Intronic
976133765 4:81912727-81912749 TTAATGCAACAATTATTTATTGG - Intronic
976309563 4:83597102-83597124 TTAATTCAAAAGTCATTTCTGGG + Intronic
977331912 4:95646718-95646740 CCATTTCACCACTTATTTATTGG + Intergenic
977839570 4:101686162-101686184 TTAATTCAACAAATATGTATTGG + Intronic
977998380 4:103524469-103524491 TTAAGTCAGAATTTATTTATGGG + Intergenic
978245470 4:106567048-106567070 TTCATTCAACAAGTATTTATTGG + Intergenic
978315437 4:107430666-107430688 TTCATTCAACAAATATTTATTGG - Intergenic
978383330 4:108153777-108153799 TTATTTAACCAGTATTTTATTGG - Intronic
978437283 4:108699206-108699228 TGATTTCTCCACTTATTTATTGG - Intergenic
978568195 4:110107244-110107266 TTTATTCAACATTTACTTATGGG - Intronic
979496971 4:121394537-121394559 TCTATTCAGCAATTATTTATTGG - Intergenic
979629961 4:122889441-122889463 ATAATGCACCAGTTTTTAATAGG + Intronic
980544840 4:134245424-134245446 TTTATTCAACAAATATTTATTGG - Intergenic
980639338 4:135555235-135555257 TTAATTCCACAGATGTTTATTGG + Intergenic
981210757 4:142101342-142101364 TGATTCCACCAGTTATTTTTGGG + Intronic
981690442 4:147502101-147502123 TTTTTTCACCATTTTTTTATAGG - Intronic
981761227 4:148197390-148197412 TTAATTCAATAAGTATTTATGGG + Intronic
981762065 4:148205566-148205588 TTAATTCAACAAATAATTATCGG + Intronic
981773884 4:148342362-148342384 TTAATTCAACAAACATTTATAGG + Intronic
982190387 4:152848304-152848326 TTTATTCACCATTTATTGAAAGG - Intronic
982472253 4:155806716-155806738 TAAATTCAACAAATATTTATTGG - Exonic
982502897 4:156180381-156180403 TAAAATTACAAGTTATTTATTGG + Intergenic
983390118 4:167119475-167119497 TTTAGTAACCTGTTATTTATTGG - Intronic
983596763 4:169476461-169476483 TTTATTCAACAGTTCTTTATTGG - Intronic
983706440 4:170665923-170665945 TTAATTCAATACATATTTATTGG + Intergenic
983803506 4:171965173-171965195 TTGATTCAACAAATATTTATGGG - Intronic
984085835 4:175310259-175310281 CTAATTCAGCTGATATTTATAGG - Intergenic
984309662 4:178041180-178041202 TGATTTAAACAGTTATTTATTGG - Intergenic
984406189 4:179333705-179333727 TTAATAAGCCAGTTATTTTTAGG - Intergenic
984570601 4:181388188-181388210 TTCATTCAACAAATATTTATTGG + Intergenic
985372427 4:189300217-189300239 TTAATTCAATATATATTTATTGG - Intergenic
985690616 5:1309722-1309744 CTAATTCACCAGGTATTGACTGG - Intergenic
986223635 5:5792990-5793012 TTAATTCAACAAATATTTATTGG - Intergenic
986278342 5:6301696-6301718 TTCATTCAGCAAATATTTATTGG + Intergenic
986683556 5:10255454-10255476 TTCATTCAACAAATATTTATTGG + Intronic
986972790 5:13356519-13356541 TTTATTCACCAAATACTTATTGG - Intergenic
987769732 5:22285588-22285610 TTCATTCAGCAGTTATTTAGTGG - Intronic
988050641 5:26025553-26025575 GTATTTCTCCAGTTATTTAGGGG - Intergenic
988152950 5:27411195-27411217 TTAATTCTCCACTTATTTGTTGG + Intergenic
988364517 5:30278865-30278887 TTAATACAACAGTAATTTAGAGG - Intergenic
988475547 5:31582023-31582045 TTCATTCAACTGTTATTTATCGG - Intergenic
988660311 5:33259325-33259347 TTCATTCAGCAAATATTTATTGG + Intergenic
988993644 5:36694181-36694203 TTTATTTAGCAGGTATTTATGGG + Intergenic
989011102 5:36874711-36874733 TTCATTCAGCAAGTATTTATTGG - Intergenic
990067311 5:51734349-51734371 TTTATTGACTAATTATTTATGGG + Intergenic
990850311 5:60195573-60195595 TTCATTCACCAGACATTTACTGG + Intronic
991097181 5:62751812-62751834 TTTGTTCACCATTTATTTAATGG - Intergenic
991224311 5:64251714-64251736 TTAGTTCAAAAGTTTTTTATGGG - Intronic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
991627812 5:68622471-68622493 TTCATTCAACAAATATTTATTGG - Intergenic
992068301 5:73127156-73127178 TTAATTCACAAGTTAGCTGTTGG - Intronic
992501263 5:77346512-77346534 TTCATTCTCCAGTTATCAATTGG + Intronic
993643719 5:90436873-90436895 ATGATTCACCATTTATTTCTGGG + Intergenic
993851589 5:93016875-93016897 TTAATTCAAGAGACATTTATGGG - Intergenic
994668747 5:102740607-102740629 TTTATTCAACAAATATTTATTGG - Intergenic
994726901 5:103446763-103446785 TTAATGCACAAAATATTTATTGG - Intergenic
994798515 5:104338730-104338752 TTAATATAGCAATTATTTATTGG + Intergenic
995126771 5:108584844-108584866 TTAATTTAACATTGATTTATGGG + Intergenic
995590181 5:113691501-113691523 TTTATTCAACAGATATTTACTGG - Intergenic
995608671 5:113886517-113886539 TTAATTCAGTAGACATTTATTGG + Intergenic
995664231 5:114523074-114523096 TTAATTGAACAGAAATTTATTGG + Intergenic
997380454 5:133432591-133432613 CTTATTCAACAATTATTTATTGG + Intronic
998681771 5:144475607-144475629 TTAATTGACAAATTATTTTTTGG - Exonic
998734314 5:145118052-145118074 TTAATTCATCAAATATTTAGTGG - Intergenic
999114637 5:149151855-149151877 TTTATTCATCAGGTATTTACTGG + Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999633320 5:153594195-153594217 TTAATTCACAGGTCATTCATGGG + Intronic
999637805 5:153640805-153640827 TAAATTCAACAGATATTTATTGG - Intronic
999690237 5:154140121-154140143 TTCATTCAACAAATATTTATTGG - Intronic
999981011 5:156957866-156957888 TTAATTTACCAAATATTCATAGG - Intronic
1000396106 5:160776235-160776257 TTAATTCTTCAAATATTTATGGG - Intronic
1000666645 5:164006033-164006055 TTAATTTACTAAATATTTATTGG + Intergenic
1001609031 5:172984906-172984928 TTCACTCAACAGGTATTTATTGG - Intronic
1002874083 6:1195835-1195857 TTGATTTACCAAGTATTTATTGG - Intergenic
1003103707 6:3197278-3197300 TTTATTCAACAAATATTTATGGG - Intergenic
1003469289 6:6413817-6413839 TTTATTCAGCACTTATTTCTTGG - Intergenic
1003485008 6:6567914-6567936 TTAGTTCCCCAATTAGTTATGGG - Intergenic
1003953030 6:11135938-11135960 TTAAGATAGCAGTTATTTATTGG + Exonic
1003983602 6:11413284-11413306 TTAGTTCAACAGTTATTCATGGG + Intergenic
1005455797 6:26018578-26018600 TTTATTCAACAAATATTTATGGG + Intergenic
1006716800 6:36125582-36125604 TTCATTCAACATTTATTTGTTGG - Intergenic
1007031230 6:38629110-38629132 TTAATTAACTAGTTAATTAATGG + Intronic
1007851540 6:44807524-44807546 TTAATTAATCAGTAATTTGTGGG + Intergenic
1009530395 6:64805005-64805027 TTAATTCAGCAAATATTTTTTGG - Intronic
1010116658 6:72319697-72319719 CTTATTCACCAGTCATTTATTGG + Intronic
1010166515 6:72920953-72920975 TCAATTCAACAGACATTTATTGG + Intronic
1010265602 6:73862487-73862509 TTATTTCACTAGTTGTTTTTGGG + Intergenic
1010518798 6:76807892-76807914 TTTTTTTACCCGTTATTTATAGG + Intergenic
1010602605 6:77849162-77849184 TTTATTCAACAATTATTTTTAGG - Intronic
1010654035 6:78490501-78490523 TTAAATCAATAGTTATTTAAAGG - Intergenic
1010923130 6:81709312-81709334 TTAATTTACCAATTATTTTCTGG + Intronic
1010985579 6:82420187-82420209 TTTATTCAACATATATTTATGGG + Intergenic
1011154908 6:84320135-84320157 TTAATTTACCAGGTATTTATTGG + Intergenic
1011631686 6:89332436-89332458 TTTATTCAACAATTATTTATTGG + Intronic
1011634871 6:89362374-89362396 TTTATCCAACAGATATTTATAGG - Intergenic
1011813626 6:91161786-91161808 TTAATTCAACACTCATTTATTGG - Intergenic
1011989724 6:93499339-93499361 GTAATTCCCCTGTTATTTATGGG - Intergenic
1012149186 6:95724314-95724336 ATAATTCACAAATTATTTACAGG - Intergenic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012866997 6:104630410-104630432 TTTATTCAATATTTATTTATGGG - Intergenic
1013135801 6:107281856-107281878 TTCATTTAACAGATATTTATAGG - Intronic
1013249975 6:108324465-108324487 TTAAGTGACCAGTTAGTTACTGG + Intronic
1014678903 6:124403581-124403603 TTTATTCAACAATTATTTAATGG + Intronic
1014815462 6:125931128-125931150 TTCATTCATCAGGTATTTACTGG + Exonic
1014953759 6:127591896-127591918 TTAATTTCTCAGTTATTTTTTGG - Intergenic
1015108802 6:129568625-129568647 TTCATTCAACAAATATTTATTGG - Intergenic
1015113233 6:129618005-129618027 TTGTTTCTCCAGTAATTTATTGG - Intronic
1015201718 6:130589933-130589955 AAAATTCACCAGTTTTTTCTAGG + Intergenic
1015210731 6:130695472-130695494 TTCATTCAACAAATATTTATTGG - Intergenic
1015335573 6:132033923-132033945 TTAATTCAACAAGTATATATTGG - Intergenic
1015686862 6:135873885-135873907 TTCATTCAACAAATATTTATTGG + Intronic
1016142656 6:140631356-140631378 TTAATTCTCCTGTACTTTATGGG - Intergenic
1016200786 6:141405169-141405191 CTAATTCAGCAGTTATCTAAAGG + Intergenic
1016432019 6:143995547-143995569 TTTATTCAACAAATATTTATAGG - Intronic
1016861344 6:148721700-148721722 TTCATTCACCAAATATTTATTGG + Intergenic
1017176665 6:151511480-151511502 TTCATTCACCAGATATTTATGGG + Intronic
1017237883 6:152136304-152136326 TTTATTCAACAGATATTTACTGG - Intronic
1017356027 6:153510276-153510298 TTAATTGACTATATATTTATGGG - Intergenic
1018889469 6:167973184-167973206 TTAATTCAGCAGATGTTTATGGG + Intergenic
1020392515 7:7673832-7673854 TTCATTCAGCAAATATTTATTGG - Intronic
1020413034 7:7914530-7914552 GTCATTCATCAGTTCTTTATTGG + Intronic
1020572120 7:9876960-9876982 TTCATTCAGCATATATTTATTGG - Intergenic
1021161355 7:17276980-17277002 TTTATTCAACAAATATTTATTGG + Intergenic
1021496860 7:21284525-21284547 TTTATTCAACAGATATTTATTGG + Intergenic
1021571341 7:22068302-22068324 TTTATTCAACATTTATTTATTGG - Intergenic
1021845546 7:24758930-24758952 TTAATTCAACAATTATTTACTGG - Intergenic
1022831614 7:34073135-34073157 TTCATTCAACAGACATTTATTGG + Intronic
1023097977 7:36682099-36682121 TGCATTCACCAGCTATTGATTGG - Intronic
1023264400 7:38391298-38391320 TTAATTTACCAAATATTTATGGG + Intronic
1023506738 7:40907404-40907426 TTATTATACCTGTTATTTATGGG - Intergenic
1023575713 7:41624093-41624115 TTAATTCAACATATATTTATTGG - Intergenic
1024391576 7:48818979-48819001 GTAATTCAGCAGCTACTTATTGG - Intergenic
1025256386 7:57386353-57386375 TTAATTCAGCAGATATTTTATGG - Intergenic
1025782124 7:64611203-64611225 GTAAGTCACCATTTCTTTATTGG + Intergenic
1025954135 7:66169637-66169659 TTAATTAACAAGCAATTTATGGG + Intergenic
1026626746 7:71999976-71999998 TTAATTTTCCAGGTATTTAGAGG - Intronic
1026973045 7:74479474-74479496 TTTATTCAGCATTTATTTCTAGG + Intronic
1027535104 7:79389939-79389961 TTATTTCCCCAATTATATATGGG + Intronic
1028060814 7:86312697-86312719 TTAATTCCTCATTTATTTCTTGG + Intergenic
1028104180 7:86857852-86857874 TTCATTTACCAATTATTTATTGG + Intronic
1028464617 7:91136326-91136348 TTAATCATCCAGATATTTATGGG + Intronic
1028606941 7:92665189-92665211 TTAACTCCCCAGGTATCTATTGG - Intronic
1028928890 7:96390988-96391010 TTTATTCAACAAATATTTATTGG - Intergenic
1029106617 7:98182184-98182206 TTTATTCAGCAGTTATTTATTGG + Intronic
1029969793 7:104777916-104777938 TTACTTCACCAGTTTCTTATTGG + Intronic
1030538396 7:110797686-110797708 TTTATTCACATGCTATTTATTGG + Intronic
1030814848 7:114023262-114023284 TTAATTCAGCAGATTTTCATTGG + Intronic
1030876202 7:114816556-114816578 TTAATTCAACAAATATTTAGTGG - Intergenic
1031061878 7:117061034-117061056 TTATTTTCCCATTTATTTATGGG - Intronic
1031160308 7:118159168-118159190 CTAATTCAAAAGTTATTTAAAGG - Intergenic
1031269141 7:119623135-119623157 TTTATTCAACAAATATTTATAGG + Intergenic
1031943770 7:127816976-127816998 TTCATTCAGCAGATATTTTTTGG + Intronic
1032867616 7:135942981-135943003 TTGGTTCTTCAGTTATTTATGGG + Intronic
1033101515 7:138476898-138476920 TTATTCCACCAGTCATTTATTGG - Intronic
1033132119 7:138753541-138753563 TTCATTCACTTGTCATTTATTGG - Intronic
1033495692 7:141892435-141892457 TTATTTCACCAGTAATTTATAGG - Intergenic
1034146765 7:148880360-148880382 ATAATTCATGAGTTCTTTATTGG - Intronic
1036092793 8:5686989-5687011 TTCACTCAACATTTATTTATTGG - Intergenic
1036613569 8:10371147-10371169 TTAATTCTTTAGTTATTTTTAGG + Intronic
1037186210 8:16066586-16066608 TTTATTCAACACATATTTATTGG + Intergenic
1038022566 8:23562488-23562510 TTCATTCAACAAATATTTATTGG + Intronic
1038973506 8:32664843-32664865 TTTATTCAACATGTATTTATTGG + Intronic
1039399580 8:37257910-37257932 TTCATTCAACAACTATTTATTGG - Intergenic
1039770530 8:40682177-40682199 TTATTTTACCATTTATATATAGG + Intronic
1040836708 8:51739540-51739562 TGAAATCACCTGTTATTTCTAGG - Intronic
1041186918 8:55310714-55310736 TTAACTCAACAGACATTTATGGG + Intronic
1041910527 8:63084411-63084433 TTCATTCAACAATTATTTTTTGG - Intronic
1042638002 8:70900274-70900296 TTAATTCACCATTTTTGCATTGG - Intergenic
1042640180 8:70925304-70925326 TTTATTCAACACATATTTATAGG - Intergenic
1044000188 8:86870071-86870093 TTAATTCACCAGACATTTCTAGG + Intronic
1044040762 8:87365805-87365827 TCAATAAACCAGTTATTTATTGG - Intronic
1044089061 8:87976931-87976953 TTAATCCAGCATATATTTATTGG + Intergenic
1044153218 8:88808866-88808888 TTATTTCAACAAATATTTATCGG - Intergenic
1044261717 8:90132440-90132462 TTCATTCAACAGATATTTATTGG + Intergenic
1045332668 8:101169161-101169183 TTCATTCAGCAATGATTTATTGG + Intergenic
1045336722 8:101211209-101211231 TTCATTCAACAAATATTTATTGG - Intergenic
1046054225 8:109060146-109060168 TTAATTCAACAAATATTTATTGG - Intergenic
1046509180 8:115177619-115177641 TTAATTCACTTGTAATTTAACGG + Intergenic
1047332924 8:123908593-123908615 TTAATTCAACAGGTTTTTTTTGG + Intronic
1047516541 8:125559688-125559710 TTTATTCAATAGTTATTTATTGG + Intergenic
1047559862 8:125975099-125975121 TTCATTCAACAAATATTTATAGG - Intergenic
1047563193 8:126011516-126011538 TAAAGTCATCAGTTATTCATTGG - Intergenic
1048701093 8:137090475-137090497 TGAATTCAACTGTTATTTCTTGG - Intergenic
1050920286 9:11192425-11192447 TCAATTTCCCACTTATTTATTGG + Intergenic
1050934475 9:11377705-11377727 TGTATTTGCCAGTTATTTATCGG + Intergenic
1052160981 9:25258410-25258432 TTCATTCAAAAGTTATTTACTGG - Intergenic
1052163965 9:25299067-25299089 GTTATTCAACAATTATTTATTGG - Intergenic
1052397151 9:27952738-27952760 TTAATTCATCTGGAATTTATTGG - Intronic
1052494072 9:29204512-29204534 TTAATTCTTCAGGTGTTTATTGG - Intergenic
1055074756 9:72202413-72202435 TAAATTCTCCAATTATTTAGAGG - Intronic
1055241633 9:74193316-74193338 TTGATTCAACAGTTATTTATTGG + Intergenic
1055621395 9:78128717-78128739 TTAATTAAGCAGTATTTTATTGG + Intergenic
1055634288 9:78259973-78259995 TTTATTCAGCAATTATTTATTGG + Intronic
1055966151 9:81866972-81866994 TTAATTAACTAATTATTAATTGG + Intergenic
1056022553 9:82455712-82455734 TTAATTAATCAATTATTTACTGG + Intergenic
1056046191 9:82719651-82719673 TTAATTCAACAAATATTTATTGG + Intergenic
1056487234 9:87071680-87071702 TTCATTCAACAAATATTTATTGG + Intergenic
1057610022 9:96533699-96533721 TTTATTCATCAAATATTTATTGG - Intronic
1057612182 9:96554864-96554886 TTAATGTAGGAGTTATTTATAGG - Intronic
1058000290 9:99857986-99858008 TCAATTTAACAGATATTTATTGG + Intronic
1058111246 9:101032603-101032625 TTCATTCAACAAATATTTATTGG - Intronic
1058264006 9:102874748-102874770 TTAATTCACGTGATATTTGTGGG - Intergenic
1059123871 9:111665109-111665131 TTAATTTTCCAGTTATTTGGAGG + Intronic
1059825306 9:118021662-118021684 TTTATTCAACAAATATTTATTGG - Intergenic
1059941448 9:119363967-119363989 TTTATTCAACAAATATTTATTGG - Intronic
1061259195 9:129470293-129470315 TTCATTCAACAATTATTCATTGG + Intergenic
1061649764 9:132038136-132038158 TTCATTCAGCAAATATTTATGGG + Intronic
1186110832 X:6254457-6254479 TTAACATACCTGTTATTTATAGG + Intergenic
1186133598 X:6495752-6495774 AAAAATCACCAGTTATTTCTTGG + Intergenic
1186669524 X:11755899-11755921 TTCATTCAGCAAATATTTATTGG - Intergenic
1187020793 X:15379325-15379347 TTTTTTCAACAGGTATTTATTGG - Intronic
1187286337 X:17907594-17907616 TTAATTCAACAAGCATTTATTGG - Intergenic
1187373457 X:18729376-18729398 ATAATGGACCGGTTATTTATAGG - Intronic
1187541585 X:20201641-20201663 TTAATTCATAAGTTAATTAATGG - Intronic
1188104237 X:26129744-26129766 TTAATTTGACAGCTATTTATTGG - Intergenic
1188149876 X:26659600-26659622 ATAATTTACCAGATTTTTATTGG - Intergenic
1188464005 X:30457631-30457653 TTTATTCAACAGCTATTTATTGG + Intergenic
1188944073 X:36276204-36276226 TTAATATACAAGTTATTTATAGG + Intronic
1189179127 X:38986890-38986912 TTAATTCAACTGTTATCTAATGG + Intergenic
1189634912 X:42996854-42996876 TTCATTCAATACTTATTTATTGG - Intergenic
1189673062 X:43432599-43432621 TTAATTGACCATATATGTATGGG - Intergenic
1190296928 X:49033101-49033123 TTTATTCAAGATTTATTTATTGG - Intronic
1192024794 X:67438065-67438087 TTAATTCCACAAATATTTATTGG - Intergenic
1192409419 X:70919847-70919869 TTAATTCACCATAGATTTGTGGG + Intergenic
1193855497 X:86596932-86596954 TCAATTAACCACATATTTATAGG + Intronic
1194622621 X:96191853-96191875 TTCATTCAACAAATATTTATTGG + Intergenic
1194975030 X:100385999-100386021 TTAATTCAACAAACATTTATTGG + Intronic
1195155066 X:102114906-102114928 TTATTTCAACAGATATTTATTGG + Intergenic
1195293537 X:103452368-103452390 TTATTTTCCCATTTATTTATTGG + Intergenic
1195760760 X:108243832-108243854 CCAATTCACCAGTTAATTACAGG + Intronic
1196039810 X:111190002-111190024 TTCATTCAACAAATATTTATTGG + Intronic
1196135109 X:112200454-112200476 TTCATTCAACAAATATTTATTGG - Intergenic
1196776988 X:119347458-119347480 TTCATTCAGCAGATATTTATTGG + Intergenic
1197507808 X:127330213-127330235 TTCATTCAACAATTTTTTATAGG + Intergenic
1197905044 X:131415663-131415685 ATAATTCAACAGAGATTTATAGG + Intergenic
1198069455 X:133133682-133133704 TTAATTCACCATTTTTCTAGGGG - Intergenic
1198318779 X:135497739-135497761 TTCATTCGCCAAATATTTATTGG - Intergenic
1198385831 X:136128627-136128649 TTTATTCAACACATATTTATTGG - Intergenic
1198535738 X:137584332-137584354 TTTATTCAACACTCATTTATTGG - Intergenic
1199014490 X:142797947-142797969 TCAATTCACCATATATCTATGGG - Intergenic
1199191179 X:144972957-144972979 TTAATTCAACAAATATTTATTGG - Intergenic
1199864994 X:151837986-151838008 TAAATTCACTTGTTATTTAGAGG - Intergenic
1200286386 X:154826753-154826775 TTACTGGACCAGTTATTTACAGG + Intronic
1200552999 Y:4601415-4601437 TTAATTTACAACATATTTATAGG + Intergenic
1201383686 Y:13414166-13414188 TTATTTAACCATTTATTTAGTGG - Intronic
1201464200 Y:14262278-14262300 TTAATTCAACAAATATTTACTGG - Intergenic