ID: 1084131810

View in Genome Browser
Species Human (GRCh38)
Location 11:67141813-67141835
Sequence GGGTGTGTATGAGGGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084131810_1084131815 -9 Left 1084131810 11:67141813-67141835 CCCTTTGCCCCTCATACACACCC 0: 1
1: 0
2: 0
3: 27
4: 282
Right 1084131815 11:67141827-67141849 TACACACCCTTCCCAGCCTCTGG 0: 4
1: 40
2: 125
3: 292
4: 984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084131810 Original CRISPR GGGTGTGTATGAGGGGCAAA GGG (reversed) Intronic
900718329 1:4159256-4159278 GGGTGAGTCTAAGGGACAAAGGG + Intergenic
902441581 1:16433537-16433559 GGGTGTGTTTGAGGGGCGTAGGG - Intronic
902893819 1:19464886-19464908 GGCTGTCTAGGAGGGGGAAAAGG + Intronic
903224023 1:21884966-21884988 GGGTGGGAATGAGGGGCAGCTGG - Intronic
904969684 1:34409453-34409475 GTGTGTGTAGGAGGGGCAGGTGG + Intergenic
905228247 1:36493876-36493898 GGATGAGTATGATGGGTAAATGG - Intergenic
905971633 1:42146170-42146192 GTGTGTGTGTGAGTGGCATATGG - Intergenic
907325208 1:53633454-53633476 GGGTGTGAATGAGTGGCTGAGGG + Intronic
907475183 1:54700687-54700709 GTGTGTATAGGAAGGGCAAAGGG + Intronic
907745573 1:57209824-57209846 GTGTGTGTGTGAGGGGGAGAGGG - Intronic
908360983 1:63367985-63368007 GGGCGTGTATATGGGGCGAAAGG - Intronic
909206134 1:72760017-72760039 GGGTGTGGATGTGGAGTAAAAGG - Intergenic
912197742 1:107419168-107419190 GGGTGTGTGAGAGAGGCTAAAGG - Intronic
912709587 1:111940846-111940868 GGGTGTGTATGTGGGGTGGAAGG - Intronic
913176565 1:116278107-116278129 GAGTGTGTGGGAAGGGCAAATGG - Intergenic
913402184 1:118448707-118448729 GGGGGTGTAGGAGGGGAAAATGG + Intergenic
913544503 1:119853793-119853815 GTGTGTGTATGAGAAGGAAAGGG - Intergenic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
917072761 1:171170229-171170251 GGGTGTGGAGGTGGGGCAAAGGG - Intergenic
917436946 1:175031593-175031615 TGGTGTGTCTGAGGGGGAACAGG + Intergenic
917762881 1:178182855-178182877 GGGTGGGTAGGTGGGGGAAATGG + Intronic
918179271 1:182072050-182072072 GTTTGTGTAGGAGGGGCAATGGG + Intergenic
919775338 1:201190747-201190769 GGGTGAGTGGGAGGGGCAGAGGG + Intergenic
920337802 1:205256959-205256981 GGGTGGGGGTGGGGGGCAAAGGG - Intronic
920795231 1:209130593-209130615 GTGTGTGTATGAAAGGAAAAGGG - Intergenic
921131515 1:212223881-212223903 GCTTCTGTATGAGGGACAAATGG - Intergenic
921351957 1:214244971-214244993 GTGTGTGTTTGAGGGGCAAGAGG - Intergenic
923052078 1:230396125-230396147 GGATGAGTATGGGGGGTAAAGGG - Intronic
1064597174 10:16957585-16957607 TGGTGTGGATGTGGGGAAAAGGG + Intronic
1066442043 10:35448683-35448705 TGGTGGGTTTGAGGGGCAGAGGG + Intronic
1068924504 10:62521308-62521330 TGGTGTGGATGAGGTGAAAAGGG - Intronic
1069786845 10:70993837-70993859 GGGTTTGTAGGAGGATCAAAGGG + Intergenic
1070370676 10:75779262-75779284 GGGTGGGGGAGAGGGGCAAAAGG - Intronic
1071704811 10:87986252-87986274 TGGTGAGCATGTGGGGCAAAAGG + Intergenic
1073714407 10:106086521-106086543 GGGTGTGTCAGAGAGGAAAAAGG - Intergenic
1074229321 10:111517739-111517761 GGGTATGTGTGAGGAGGAAATGG + Intergenic
1074343239 10:112655130-112655152 GGGTGTGTATGGGGGGTGGAGGG - Intronic
1075099061 10:119493209-119493231 GGCTGTGAATGAGGGGGAAGGGG + Intergenic
1076332023 10:129677090-129677112 GGGTGTCTCTGATGGGCCAAGGG + Intronic
1076742027 10:132490526-132490548 GGGTGTGCACGAGGGGAGAAGGG - Intergenic
1077219547 11:1409639-1409661 GGGGGTGTATGAAGGGCACAAGG + Intronic
1079420835 11:20286145-20286167 TGGTGTGGATGAGGAGAAAAGGG - Intergenic
1080290359 11:30664160-30664182 GGGTGTAAATGAGGGGTAGAGGG + Intergenic
1080844213 11:36012619-36012641 GTGTGTGTATGCTGGACAAAGGG + Intronic
1081914032 11:46719525-46719547 GGCAGTGTAGGAGGGGCACAGGG + Intronic
1081981126 11:47268025-47268047 AGGTGTGGAGGAGGGGCAATGGG + Exonic
1082255062 11:50024999-50025021 TGGTGTGGATGAGGTGAAAAGGG - Intergenic
1083711716 11:64553816-64553838 GGGTGTCCATGACAGGCAAAGGG + Intergenic
1084060470 11:66669866-66669888 TGTTGTGTATAAGGGGAAAAAGG - Intronic
1084131810 11:67141813-67141835 GGGTGTGTATGAGGGGCAAAGGG - Intronic
1084168235 11:67387069-67387091 TGGGGTGGATGAGGGGCATAGGG + Intronic
1084686228 11:70697467-70697489 GGGTGGGTGCGAGGGGCAATGGG + Intronic
1085465814 11:76722521-76722543 AGGTGTGTATGCAGGGCACAGGG - Intergenic
1085661405 11:78370737-78370759 GTGTGTGTGTAAGGGGTAAATGG + Intronic
1086588229 11:88481084-88481106 GGGTGATTATGAGGGCCAAATGG - Intergenic
1089325371 11:117653188-117653210 GGGTGTGTGTGTAGGGGAAATGG + Intronic
1090657005 11:128854024-128854046 GGGTGGGTATGAGGGCCCACGGG - Intronic
1093766743 12:22972166-22972188 GGTTGCGTATGAGGGCCAAAAGG - Intergenic
1094681585 12:32671997-32672019 GGGTGTGGGTGTGGAGCAAAGGG + Intergenic
1096580021 12:52579064-52579086 GAGTGTGTGTGAGGGGAAAAGGG - Intergenic
1096982415 12:55736119-55736141 AGGTGAGTGTGAGGGGCAGAAGG - Intergenic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1100417007 12:94388437-94388459 GGGAGAGGATGAGGGGGAAAGGG + Intronic
1101807544 12:108077668-108077690 GGGTGTGTGTGAGAGGAGAAGGG - Intergenic
1102002021 12:109563355-109563377 GGGTGTCTGTGAGGGTGAAATGG + Intronic
1102386905 12:112517444-112517466 GGGTGGAGATGGGGGGCAAATGG + Intergenic
1104272037 12:127290977-127290999 TGGTGTGTTTGAGGGACGAAGGG - Intergenic
1104626274 12:130358207-130358229 GGGTGTGTGGGAGGTGCAGAGGG + Intronic
1106209947 13:27632750-27632772 GTGTGTGTTTGAGGGGTAGAGGG - Intronic
1106463849 13:29995506-29995528 GTGTGTGTGTGAGGGGCAGGAGG + Intergenic
1107821312 13:44288376-44288398 AGGGGTATATGAGAGGCAAATGG + Intergenic
1109278840 13:60332039-60332061 GGGTGGGTAAGAGGTGGAAAGGG + Intergenic
1109372787 13:61445893-61445915 GGGTGTGCTTCAGGGGCAGAGGG + Intergenic
1111269328 13:85860359-85860381 GGGTGTGTATGTGGGTGCAAGGG + Intergenic
1113717328 13:112521115-112521137 GGGTGTGTATGTGGGTCAGTTGG - Intronic
1114221543 14:20701911-20701933 GGGTTTGTATTAGGGCCAAACGG - Intergenic
1116944178 14:50820592-50820614 GTGAGTGCATGAGGAGCAAATGG + Intronic
1118186332 14:63542415-63542437 GGGTGTGGGTTAGGAGCAAAGGG - Intronic
1119887072 14:78152125-78152147 AGGTGTTTATGTGGGGAAAAAGG + Intergenic
1120630534 14:86884430-86884452 GAGTATGTATGAAGGACAAAGGG - Intergenic
1122542934 14:102508003-102508025 GGGGCTGTGTGAGGGGCAGAGGG - Intronic
1122865209 14:104600828-104600850 AGGTCTGTTTGAGGGGCACATGG - Intronic
1123828404 15:24106872-24106894 TGGTGTGGATGAGGTGAAAAGGG - Intergenic
1123843312 15:24270453-24270475 TGGTGTGGATGAGGTGAAAAGGG - Intergenic
1123863022 15:24487135-24487157 TGGTGTGGATGAGGTGAAAAGGG - Intergenic
1124220561 15:27846844-27846866 GGGTGAGGATGGGGGGCAAGTGG + Intronic
1124957003 15:34366526-34366548 GGGAGTGTAGGAAGGGCACAGGG + Intronic
1125377514 15:39046613-39046635 GGGTGCGGATGAGGGATAAAAGG + Intergenic
1126041844 15:44598963-44598985 GGGTATGTGCAAGGGGCAAAAGG - Intronic
1127313826 15:57776469-57776491 GGGTGGGGAGGAGGGGGAAAGGG + Intronic
1127887494 15:63215146-63215168 GGATGGGTATGAGGGACAAAGGG - Intronic
1127907553 15:63387449-63387471 GGCTGTGTCTGAGGGACCAAGGG + Intergenic
1128657162 15:69470723-69470745 GGGTGGGGGTGAGGGGCAGAAGG - Intergenic
1129807171 15:78472285-78472307 GGGTGTGGGTGAGTGGCTAAAGG - Intronic
1130853864 15:87823546-87823568 GGGTTTGCAGGAGGGACAAAGGG - Intergenic
1130891273 15:88135851-88135873 GGCTGTGTGTGAGGGGCAACTGG - Intronic
1130936222 15:88473005-88473027 AGGAGTGTATGAGGGGCATATGG + Intronic
1130993170 15:88888912-88888934 TGGTGGGTGTGTGGGGCAAATGG - Intronic
1132695467 16:1199849-1199871 GGAAGCGGATGAGGGGCAAAGGG - Intronic
1132843740 16:1990602-1990624 GGGTGTGTGTGCGGGGGAAGGGG - Intronic
1133701186 16:8310636-8310658 GGGGGTGCATGAAGGGCAGAAGG + Intergenic
1134145783 16:11760380-11760402 GGTTATGTAGGAGGGGGAAAGGG - Intronic
1134680699 16:16123071-16123093 GAGTGTGTAAGACGGGCTAATGG - Intronic
1135948627 16:26890319-26890341 TGGTGTGAATGAGGGGAAAAGGG - Intergenic
1139498147 16:67336453-67336475 TGGTGAGGATGTGGGGCAAAAGG - Intronic
1140045491 16:71437876-71437898 GGGTGTGTAAGTGAGGCAGAGGG - Intergenic
1141830519 16:86507768-86507790 GTGTGTGTGTGTGTGGCAAATGG - Intergenic
1142139557 16:88466758-88466780 GGGTGTGTATGTGGGGGAGGGGG + Intronic
1142368440 16:89663685-89663707 GGGTGTGTCTGAAGGGCAGCAGG + Intronic
1143055301 17:4157897-4157919 GGGTGAGACTGAGCGGCAAAGGG - Intronic
1143173933 17:4945833-4945855 GTGTGTGTATGGGGAGGAAAGGG + Exonic
1144142995 17:12368174-12368196 GGGTGTGGAGAAGGGGGAAAAGG - Intergenic
1146374302 17:32284150-32284172 GGGTGTGTGGGAGGGGCCATGGG + Intronic
1146522609 17:33537853-33537875 GTGTGTCTAGGAGGGGCAATAGG + Intronic
1146915541 17:36676183-36676205 GGCTGTGTTTGAGGGTCAGAGGG - Intergenic
1147190380 17:38734969-38734991 GTGTGTGTATGTGTGGAAAATGG - Exonic
1147289150 17:39427581-39427603 TTGTGTGTATAAGGTGCAAATGG + Intronic
1148804707 17:50258314-50258336 GGGTGTCTGTGAGGGCCACATGG - Intergenic
1148897270 17:50846093-50846115 AGGTGTCTGTCAGGGGCAAAGGG + Intergenic
1149141808 17:53440253-53440275 GGGTGTGTGTGAGGGGACAGGGG - Intergenic
1149539614 17:57459123-57459145 GGGTGTTTATGTGGCACAAAAGG + Intronic
1151077493 17:71290220-71290242 GGGAGTGTATGATGGGCATTGGG + Intergenic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1151600327 17:75102177-75102199 GGGTGTGCATGGGGATCAAAAGG + Intronic
1151821719 17:76500547-76500569 GGGTGTGTCTGAGGAGCAGAAGG - Intronic
1152047205 17:77945025-77945047 GGGTGTGTATCAGGGGAACAAGG - Intergenic
1155370045 18:25089329-25089351 TTGTGTGTATTGGGGGCAAAGGG - Intronic
1156248242 18:35324308-35324330 GTGTATGTATTAGGGGAAAAAGG + Intergenic
1156580995 18:38374774-38374796 GGGAGTGTGTGATAGGCAAAAGG - Intergenic
1157245919 18:46055223-46055245 GGATGTGTATGAGGGACAGAGGG - Intronic
1157423708 18:47567431-47567453 TGGTGGGGATGAGGGGCACAGGG - Intergenic
1158320311 18:56255073-56255095 TGGTGTGTAACATGGGCAAATGG - Intergenic
1158403055 18:57138703-57138725 GGGTGTGCATGTGGGGCAGAAGG - Intergenic
1158419494 18:57280186-57280208 GGGTGGGAATCAGGGGCTAACGG - Intergenic
1159830818 18:73276369-73276391 GTGTGTGTATGTGAGGCAACGGG - Intergenic
1161348575 19:3779765-3779787 GGGTGAGTACCTGGGGCAAAAGG - Exonic
1163506163 19:17707624-17707646 GGCTGGCTATGGGGGGCAAATGG - Intergenic
1163796652 19:19341926-19341948 GGGTGGGTCTGAGTGGCACAGGG - Intronic
1164711361 19:30359348-30359370 TGGAGTGTATGAGGTGCAAATGG + Intronic
1164828482 19:31301847-31301869 GGGTGGGTATGAGGGGCCTTTGG - Intronic
1165251589 19:34541007-34541029 GTGTGTGTATGTGGTGCACAGGG - Intergenic
1165762527 19:38329995-38330017 TGGTGGGTGTGTGGGGCAAAAGG + Intergenic
1165771100 19:38380778-38380800 GGGTGTGGCTGTGTGGCAAAGGG + Intronic
1167203001 19:48080337-48080359 TGGTGTGGATGCGGTGCAAATGG + Intronic
1167284033 19:48588845-48588867 GGGTGTATCTGAGGTGCAAGAGG + Intronic
1167694849 19:51009343-51009365 GGGTGGGGATGAGGGACAAAGGG + Intronic
925200031 2:1959675-1959697 GGAGGTGTGTGAGGGGCAGAGGG - Intronic
926786045 2:16519376-16519398 GGGTGTGAGTGAGGGGAGAAAGG + Intergenic
930033117 2:47070190-47070212 GGGAGGGGATGAGGGGAAAAGGG - Intronic
930255736 2:49088178-49088200 GCGTGTGTATGTGGTGCAGAGGG + Intronic
931246437 2:60496317-60496339 TGGTGTTACTGAGGGGCAAAGGG + Intronic
931668046 2:64624282-64624304 GGGTGTGTGTGGGTGGGAAAGGG + Intergenic
933730938 2:85455860-85455882 GGGTGGGGAGGAGGGGGAAATGG + Intergenic
936614681 2:114036206-114036228 TGGTGTGGATGAGGTGAAAAGGG - Intergenic
937348543 2:121143681-121143703 GGGTGTGTGTGAGGATCAACAGG + Intergenic
940892499 2:159048452-159048474 GGGTTTTTATGAGGAGGAAATGG + Intronic
941554212 2:166955410-166955432 TTGTGAGTATGAGGGGCAAGAGG + Intronic
942239671 2:173949038-173949060 TGTTGTGTAAGAGGGGCAAAAGG + Intronic
944603445 2:201327668-201327690 TGGTGTGGATGTGGGGAAAAGGG + Intronic
944949916 2:204736911-204736933 TGGTGTGGATGTGGGGAAAAGGG - Intronic
945052959 2:205842932-205842954 GTGTGTGTGTTAGGGGTAAAGGG - Intergenic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
948704322 2:239779667-239779689 GGGGTTGTGTGAGGGGCACAAGG - Intronic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948962109 2:241347489-241347511 GTGAGTGAACGAGGGGCAAAGGG - Intronic
949049060 2:241887516-241887538 GGGTGGGGGTGAGGGGCAAATGG - Intergenic
1170674227 20:18464416-18464438 GTGTATGTATGAGGTGCACAGGG - Intronic
1171326457 20:24297832-24297854 GGGTGGGAATGAGGGCCAAGAGG + Intergenic
1171421459 20:25020569-25020591 GGGTGTGCATGCCGGGCACATGG - Intronic
1172501614 20:35432056-35432078 TGGTGTGTGTGAGGGGAGAATGG - Intergenic
1174407139 20:50309936-50309958 GGGAGTGAGTGAGGGGCAGAGGG + Intergenic
1174571570 20:51505823-51505845 GGGTGTGAGTTAGGGGCAGACGG - Intronic
1174736435 20:52970262-52970284 TGGTGTGGATGTGGGGAAAAGGG + Intergenic
1175016160 20:55792932-55792954 TGGTGTGGATGAGGTGAAAAGGG + Intergenic
1175336002 20:58196690-58196712 GGGTGTGGATGAGGAGCCACAGG - Intergenic
1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG + Intergenic
1176935662 21:14863879-14863901 GGGTGTGTATGAAAAGCATAGGG + Intergenic
1181138448 22:20786211-20786233 GGGTGGGTAGGAAGGGCAAGTGG - Intronic
1182156609 22:28079504-28079526 GGATGGGTAGGAGGGGTAAAAGG - Intronic
1184482924 22:44758666-44758688 GGGTGTATTTGAGGGGCAGCCGG + Intronic
950454559 3:13084905-13084927 GGGAGTGTATGGGATGCAAAAGG + Intergenic
952873798 3:37925077-37925099 GGATGTTTATGAGGGAGAAATGG - Intronic
953025330 3:39141811-39141833 GGGTGGGAAGCAGGGGCAAAGGG - Intergenic
953080699 3:39614624-39614646 TGGTGTGGATGTGGGGAAAAGGG + Intergenic
953563861 3:44014614-44014636 GGGTGGGGTTGAGGGGCAGATGG - Intergenic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
953921401 3:46954417-46954439 GGGTGTGTGTGGGAGGCGAAAGG - Intronic
954149516 3:48650459-48650481 GGGTGAGTATGTGGGGGGAAAGG - Exonic
954521637 3:51232508-51232530 GGGTGTGGATGTGGTGAAAAGGG - Intronic
954971135 3:54652613-54652635 GGATGTGTATGAGGAGCAGGAGG + Intronic
954974778 3:54683061-54683083 GGGTGTGAATGAAGGGGAAGAGG - Intronic
955737824 3:62058515-62058537 AGGTGTGTATGAGGGGGAGGGGG - Intronic
956141089 3:66147721-66147743 TAGTGTGTATGTGGTGCAAAGGG - Intronic
957213010 3:77285131-77285153 GGGTGTGTGGAAGGGGCATAGGG + Intronic
959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG + Intronic
962468882 3:135687445-135687467 GTGTGTGTTGGAGGGGCAAAGGG + Intergenic
964290506 3:155174370-155174392 GTGTGTGTGTGAAGGGTAAATGG + Intronic
966216862 3:177512891-177512913 GGTTGTGTGTGTGGGGGAAAGGG + Intergenic
966562385 3:181337399-181337421 TGGTGTGTATGTGGGGCCAGAGG + Intergenic
966757538 3:183385458-183385480 TGGTGTGTATGAGGTGAAACTGG + Intronic
969335754 4:6509017-6509039 GGATTCGTCTGAGGGGCAAAAGG - Intronic
969836706 4:9848268-9848290 GGCTGTGTAGAAGGGGAAAAAGG - Intronic
970451992 4:16178111-16178133 GGGTGTCCATGAAGGGCAGAGGG - Intronic
974145923 4:57947176-57947198 GGTTGTTTATGAGGAGCAAATGG + Intergenic
975667925 4:76752286-76752308 GGGTTAGTAGGAGGGGGAAATGG + Intronic
976960420 4:90964831-90964853 GAGTGTTTATTAGGGGTAAATGG + Intronic
977039499 4:91997989-91998011 GGGTGGGGATGAGGGTTAAAAGG + Intergenic
978298057 4:107232300-107232322 TGGTGAGTATGAGGAGAAAAGGG + Intronic
978367037 4:107993173-107993195 GAGTGGATATGAGGGGAAAAGGG - Intronic
979790287 4:124772037-124772059 TGGTGTGTATGTGGTGAAAAGGG - Intergenic
979871776 4:125832447-125832469 TGGTGTGTATGTGGAGAAAAAGG + Intergenic
980095214 4:128483031-128483053 GGGAGTGTATGTGGTGGAAAGGG - Intergenic
981031713 4:140132008-140132030 GAGTGTGTATGTGCGGCAATTGG + Intronic
985168249 4:187120654-187120676 GTGTGTGTTTGAGGAGCTAAAGG + Intergenic
985319122 4:188689161-188689183 TGATGTGTATGGGGGGCATATGG + Intergenic
985477331 5:85533-85555 GGGAGTGTGTGTGGGGCAGAGGG + Intergenic
985547205 5:515744-515766 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547212 5:515772-515794 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547219 5:515798-515820 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547226 5:515826-515848 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547233 5:515852-515874 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547240 5:515880-515902 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547247 5:515908-515930 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547254 5:515934-515956 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547261 5:515964-515986 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547268 5:515990-516012 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547283 5:516043-516065 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985558245 5:568655-568677 GGCTGTGAATGTGGGGCAAGGGG - Intergenic
985604022 5:849161-849183 GGCTGTGTATGCAGGGCCAATGG - Intronic
986758345 5:10857867-10857889 GGGTGTGTGTGATGCGCTAAGGG - Intergenic
987025376 5:13921731-13921753 GGGTGTGTGTGGGCGGCAGATGG - Intronic
988883234 5:35528284-35528306 TGGTGTGTATATGGGGCAAGAGG + Intergenic
989202810 5:38782309-38782331 GGGTGTGTGTGAGAAGGAAATGG - Intergenic
991443713 5:66678256-66678278 GGGTGTGTATGGGGGGAATGGGG + Intronic
992359930 5:76026868-76026890 GGAGGTGGATGAGGTGCAAATGG + Intergenic
995347380 5:111136035-111136057 GGGTCTTTATGAGGCGCAGATGG + Intergenic
996368789 5:122731274-122731296 GGGTGTGTGTGTGTGGCAAGGGG - Intergenic
998059533 5:139108852-139108874 GGATGTGAAGGAGGGGAAAAGGG + Intronic
998773560 5:145573151-145573173 ATGTGTATATGAGGGGGAAAAGG - Intronic
999881948 5:155874770-155874792 TGGTGAGTATGTGGAGCAAATGG + Intronic
1000463268 5:161547662-161547684 GGGTTTGCATGAGGGGGAGATGG + Intronic
1000474490 5:161688545-161688567 GAGGGTGAATGAGGTGCAAAGGG + Intronic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001877387 5:175213351-175213373 GGGAGTGCATAAGGGGAAAAGGG - Intergenic
1002261199 5:177995159-177995181 GGGTGTGTCTGAGCGGAAGAGGG - Intronic
1004328616 6:14700635-14700657 GGATGTACATGAGGAGCAAAGGG + Intergenic
1004418202 6:15444555-15444577 GTGTGTGTCTGGGGGGCGAATGG + Intronic
1004734190 6:18388472-18388494 GGGTGTGGGTAAGAGGCAAAAGG + Intronic
1005899812 6:30207500-30207522 GAGTGTGTTTGAGGATCAAAAGG - Intronic
1006665679 6:35691319-35691341 GGGTGTGGACAAGGGGGAAAGGG + Intronic
1007000504 6:38307825-38307847 GCATGTGTTTGAGGGGCAAAAGG - Intronic
1007208446 6:40171791-40171813 GGGTGGGGGTGAGGGGCAACTGG + Intergenic
1007389434 6:41542056-41542078 GGGTGTGACGGAGGGGCACAAGG - Intergenic
1009213935 6:60896775-60896797 GGGTTTGGAGGAGGGGAAAACGG - Intergenic
1009799014 6:68509159-68509181 TGGTGTGGATGAGGTGAAAAGGG - Intergenic
1010000067 6:70940158-70940180 GGGTGTGTGTGTGGGGCGAGGGG - Intronic
1011614915 6:89189060-89189082 GTGTGTGTGTGTTGGGCAAAGGG + Intronic
1012735578 6:102937075-102937097 GGGTGAGAATGTGGGGCAAGAGG - Intergenic
1013374156 6:109497910-109497932 GGGAGTGGATGAGGTGCTAAGGG + Exonic
1015875613 6:137819036-137819058 GGGTGTGTGTTAGGGGAAAGGGG - Intergenic
1016758209 6:147710241-147710263 GGGTGGGTAGGAGGAGCACATGG - Intronic
1017861149 6:158398395-158398417 GGGTGAGGAGGAGGGGGAAAGGG - Intronic
1017953682 6:159160340-159160362 GGGTGTAAATAAGGGGGAAAAGG + Intergenic
1018074590 6:160200654-160200676 GGGAGGGAATGAGGGGCAACAGG - Intronic
1020849546 7:13333817-13333839 GTGTGTGTAGGTGGGGCAAGGGG - Intergenic
1020972363 7:14961305-14961327 GGGTGTGTCTGAAGAGAAAATGG - Intronic
1021261495 7:18463360-18463382 AGGTGTGTGTGTGGGGCAAGGGG + Intronic
1022034367 7:26519686-26519708 GTGTGTGTATCACGGGCCAAGGG - Intergenic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024296718 7:47849695-47849717 GGTTGTGTATGTGGTGAAAAGGG + Intronic
1024817635 7:53289330-53289352 AGGTGGGTTTGAGGGGCAGAAGG - Intergenic
1025222139 7:57120997-57121019 GGGTGAATATGAGGTGCACAAGG - Exonic
1027530052 7:79319200-79319222 GGATGTGTATGAAGGAAAAATGG - Intronic
1027842798 7:83335425-83335447 GGAGGTGAATGAGGGGCAAGTGG + Intergenic
1029715767 7:102324602-102324624 GGGTCTGGGTGAGGGGCAAGGGG + Intergenic
1032634046 7:133686717-133686739 GGGTGTGGATGTGGTGAAAAGGG + Intronic
1033412609 7:141132700-141132722 GGGTGTGTAGGAGGGTCATCAGG - Intronic
1034543792 7:151776810-151776832 GTGTGTGGATTAGGGGCACAGGG + Intronic
1035721605 8:1797196-1797218 GGGTGACTGTGGGGGGCAAAGGG - Intergenic
1037217475 8:16475109-16475131 GGGCCTGGATGAGGAGCAAATGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1042648366 8:71012390-71012412 GGGTGTGTTTGAGGGTGAACAGG + Intergenic
1044876850 8:96677307-96677329 TGGTGTGTATGTGGTGAAAAGGG - Intronic
1045407983 8:101886351-101886373 AGTTGTGTATGAGGAACAAATGG - Intronic
1046238924 8:111464706-111464728 TGGTGTGGATGTGGGGAAAAGGG + Intergenic
1046747951 8:117896442-117896464 GGGAGTGTATATGGAGCAAAAGG + Intronic
1048248510 8:132836189-132836211 GGGTTTTTATGAGGGTCAGAAGG + Intronic
1049378755 8:142301662-142301684 GTGTGTGTGTGAGGGAAAAAGGG + Intronic
1049632438 8:143665815-143665837 GGGTGGGGACGAGGGGCACAGGG + Intergenic
1052674791 9:31606877-31606899 GGATCTGTATAAGTGGCAAAGGG - Intergenic
1053129665 9:35607786-35607808 GGGTGCCTGTGAGGGGCAAAGGG - Intronic
1056319039 9:85419445-85419467 TGGTGTGGATGAGAGCCAAAGGG + Intergenic
1058049190 9:100389470-100389492 GGGTATGTATGAAGAACAAAGGG - Intergenic
1058797683 9:108514249-108514271 TGGTGTGTCTAAGGGGCAGATGG + Intergenic
1060128315 9:121072132-121072154 AGGTCTGTATGAGGAGGAAAAGG + Intergenic
1060549908 9:124479980-124480002 GGGTGTGTATAGGGGACAAGAGG - Intergenic
1187072071 X:15898487-15898509 TGGTGGTTATGAGGGGCAGAGGG - Intergenic
1189675710 X:43458561-43458583 GGTTGTATTTGAGAGGCAAAGGG - Intergenic
1190125880 X:47705018-47705040 GGTTGTATCTGAGAGGCAAAGGG + Intergenic
1190428567 X:50355561-50355583 GGGTGTGGATGTGGTGAAAAAGG - Intergenic
1191671645 X:63753994-63754016 GGGTTTGTTTGAGGGGAAAAGGG - Intronic
1193460354 X:81784276-81784298 TGGTGTGGATGTGGGGAAAATGG - Intergenic
1194656040 X:96575029-96575051 GGGGGTGGATGAGGGGCACAAGG - Intergenic
1195168867 X:102246897-102246919 GGGAGTGTGTGAGGTGGAAAGGG - Intergenic
1195189990 X:102440189-102440211 GGGAGTGTGTGAGGTGGAAAGGG + Intronic
1195308331 X:103607769-103607791 GGGTGTGTTTGTGTAGCAAAGGG - Intronic
1198087338 X:133293581-133293603 TGGTGTGTATTAGGTGTAAAGGG + Intergenic
1198324786 X:135558593-135558615 GGGGCTGTGTGAGGGGAAAATGG + Intronic
1198435023 X:136608811-136608833 TGGTGTGAATATGGGGCAAAGGG + Intergenic
1198984325 X:142431861-142431883 AGGTGTGTATGGGGAGCATATGG - Intergenic