ID: 1084142933

View in Genome Browser
Species Human (GRCh38)
Location 11:67245728-67245750
Sequence TAGATTAGAAAGGACCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084142933 Original CRISPR TAGATTAGAAAGGACCGGGG AGG Intronic
900743250 1:4343330-4343352 GGGATTAGAAAGGACTGGTGTGG - Intergenic
903385024 1:22920529-22920551 AAGATTAGAAAGGTCAAGGGGGG - Intergenic
904198802 1:28805679-28805701 TAGATGACAGAGGGCCGGGGGGG + Intergenic
906938214 1:50233162-50233184 TGGATTAGAGAGGACCAGAGTGG + Intergenic
907154676 1:52322670-52322692 TAGTTTTGAAAGGACCAGGCTGG - Intronic
908295445 1:62708200-62708222 TGGATTAGAAATGACAGGTGAGG + Intergenic
911412174 1:97523574-97523596 GAGATTAGAAAGGGCGGGGAGGG - Intronic
912496573 1:110095539-110095561 TAGATTAGAATGGGGAGGGGAGG - Intergenic
912734503 1:112138271-112138293 TAGATTATAAAGGACCTTGAAGG - Intergenic
922777108 1:228220049-228220071 TAGAGTAGAAAGAACCAGGAAGG + Intronic
922845074 1:228678262-228678284 TAGATTAGAATGGGCCTGTGAGG + Intergenic
1064586156 10:16841570-16841592 TAGATTAGAAAGGTCAGGGGTGG - Intronic
1066406688 10:35126108-35126130 TAGATTAGAAAGGTCGGCCGGGG - Intergenic
1066975341 10:42363284-42363306 AAGATTAGAAAGGAGATGGGAGG - Intergenic
1067323862 10:45247889-45247911 GAGATCAGAAAGGTCAGGGGTGG - Intergenic
1074587123 10:114778761-114778783 TAGAGTAGAAAGGAATGGGAGGG - Intergenic
1076284252 10:129277669-129277691 CAGATTAGAAAGGACAGAAGAGG + Intergenic
1076513997 10:131033007-131033029 TAGATCAGAAGGGACCTGGGTGG - Intergenic
1077628965 11:3797849-3797871 TAGATTGGGAAGCACCGGCGGGG + Intronic
1078889218 11:15538991-15539013 TAAATTAGAGAGGAGTGGGGAGG + Intergenic
1079476380 11:20834085-20834107 TAGATTGGAATGGGCCGGCGTGG + Intronic
1080615819 11:33943890-33943912 TATAATAGAAGGGACTGGGGAGG + Intergenic
1081077555 11:38695739-38695761 TAGTTTAGGAAGGACCCTGGGGG - Intergenic
1084142933 11:67245728-67245750 TAGATTAGAAAGGACCGGGGAGG + Intronic
1087155526 11:94898177-94898199 TAGATTACAATGAACTGGGGTGG + Intergenic
1091151372 11:133331360-133331382 CAGAGTAGAGAGGACTGGGGTGG - Intronic
1095709654 12:45274822-45274844 TAGATGAGAAAGGAGTTGGGAGG - Intronic
1096693674 12:53335771-53335793 AAAGTTAGAAGGGACCGGGGTGG + Intronic
1112203647 13:97302775-97302797 TAGAATAGAAAGGAAGGGTGAGG + Intronic
1114259779 14:21028107-21028129 TGGAGTGGAATGGACCGGGGTGG - Intronic
1115613678 14:35072850-35072872 TAGATATGAAAGGAAAGGGGGGG - Intronic
1121042865 14:90763462-90763484 TTGATTAGAAATGACCAGAGTGG - Intronic
1123926149 15:25113628-25113650 TAAACTAGAAAGGCCGGGGGTGG + Intergenic
1124834192 15:33179933-33179955 TAGATAAGTAAGGAGCTGGGAGG + Intronic
1126747803 15:51844262-51844284 TAGATTTGGAAGGACCTTGGAGG + Intronic
1128626554 15:69212586-69212608 TAGATAAGAAAGGACCTGAATGG + Intronic
1128776253 15:70322754-70322776 TAGATTAGAAAGCACCTCAGTGG + Intergenic
1138745362 16:59356893-59356915 CAGATAAGAAATGACCTGGGAGG - Intergenic
1140158798 16:72462603-72462625 TAGATTAGAAAGCAACAGGCCGG - Intergenic
1149424061 17:56538184-56538206 TAGCTAAGAGAGGAACGGGGAGG - Intergenic
1150947639 17:69765469-69765491 GAGAGCAGAAAGGAACGGGGAGG - Intergenic
1152597687 17:81245944-81245966 GAGATGAGAAAGGCCCGCGGGGG - Exonic
1155371967 18:25111299-25111321 TAGATTAGTAAGGACAGTGTGGG - Intronic
1156484104 18:37453940-37453962 TAGATCAAACAGGACGGGGGTGG - Intronic
1161423216 19:4187109-4187131 AAGATTAGAAAGGGAAGGGGAGG + Intronic
1163870507 19:19817285-19817307 AAGATTAGAAAGGAGGTGGGAGG - Intronic
1163879293 19:19903240-19903262 AAGATTAGAAAGGAGGTGGGAGG + Intronic
1163908713 19:20169765-20169787 GAGATTAGAAAAAAGCGGGGAGG + Intronic
1163948517 19:20562946-20562968 AAGATTAGAAAGGAGGTGGGAGG - Intronic
1165252617 19:34552856-34552878 TGGTTTAGAAAGGAGAGGGGGGG + Intergenic
1165522403 19:36325011-36325033 TGGTTTAGAAAGGAGAGGGGGGG + Intergenic
1168665639 19:58202972-58202994 TACATTAGAAAGGGGTGGGGTGG + Intronic
925841442 2:7995697-7995719 AAGATTAGAAATGACCAAGGAGG - Intergenic
926106269 2:10153863-10153885 TAGAATAGCAGGGACTGGGGAGG + Intronic
934574816 2:95393153-95393175 CAGATTGGAAAGGACCCGAGTGG + Intergenic
934852786 2:97712088-97712110 TGGTTTAGAAAGGACAGGTGGGG + Intergenic
937727397 2:125183600-125183622 TAGATTAGAAAGGGAGGGAGTGG - Intergenic
938835876 2:135103617-135103639 TAGATTAGAGAGAAGAGGGGAGG - Intronic
939874351 2:147559927-147559949 TAGAGTTGAAAGGACTGGAGAGG - Intergenic
940006431 2:149012819-149012841 GAGATTAGATAGGAATGGGGTGG - Intronic
944881168 2:204014423-204014445 TAGATTGGAAAGGACTGGTCTGG - Intergenic
945612948 2:212028958-212028980 TAGCTAAAACAGGACCGGGGTGG + Intronic
1170125403 20:12957303-12957325 AAGATTAGAGAGGACAGGGAAGG + Intergenic
1173946288 20:46953470-46953492 TAGATTAGAATGAGCCGGGTTGG + Intronic
1176922040 21:14699373-14699395 TAGACTAGAAAGGAAGAGGGTGG - Intergenic
1181991874 22:26843127-26843149 CAGATAAGAAAGGTCCAGGGAGG - Intergenic
1203299610 22_KI270736v1_random:67863-67885 TAGATTAGAAACGACTGCAGTGG + Intergenic
1203306945 22_KI270736v1_random:115861-115883 TAGAGTGGAAAGGAACGGAGTGG + Intergenic
1203307540 22_KI270736v1_random:119890-119912 TGGAATAGAAGGGACTGGGGTGG + Intergenic
1203309048 22_KI270736v1_random:129772-129794 TGGATTAGAATGGAGCGGAGTGG + Intergenic
1203311822 22_KI270736v1_random:148065-148087 TAGAATGGAATGGACCGGGATGG + Intergenic
956559444 3:70558192-70558214 CAGAATAGAAAGGACATGGGGGG + Intergenic
957682551 3:83456003-83456025 TAGATAAGAAAGCACAGGGCTGG - Intergenic
962044445 3:131740666-131740688 TAGTTTAAAGAGGACAGGGGAGG - Intronic
962146464 3:132844929-132844951 TAGGTTAAAATGGACCAGGGTGG + Intergenic
962904826 3:139792040-139792062 TTGATTAGAAAGTAGCGAGGGGG + Intergenic
967903296 3:194479080-194479102 GAGATTAGAAAGGATTGGGGCGG + Intronic
970589635 4:17547988-17548010 TAGAGAAGAAAGGATCGGGGAGG + Intergenic
970720580 4:18984037-18984059 TAGATTATAAAGCACAGGCGTGG + Intergenic
973635215 4:52856025-52856047 CAGCTTAGAAAGGACTGGGAAGG - Intergenic
977964480 4:103128053-103128075 TAGATTAGAAAGTAAAGGGATGG + Intronic
978361427 4:107934308-107934330 TTGATTAGAAGGGACTGGGAAGG - Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
987238789 5:15971515-15971537 TACATTAGAAAGCACCTTGGGGG + Intergenic
998623803 5:143823275-143823297 TAGATTAGAGAGGGCCTGAGTGG - Intergenic
999117573 5:149177212-149177234 TAGAGCAGAAAGGGCCTGGGAGG - Intronic
1000623301 5:163509499-163509521 TAGATCACAAAGGTCTGGGGTGG - Intronic
1004478715 6:15998937-15998959 GAGATAAGAAGGGACGGGGGTGG + Intergenic
1009219354 6:60964954-60964976 GAGATAAGCAAGGACCAGGGAGG + Intergenic
1020075488 7:5255308-5255330 TAGATTAGAAAAAACAGTGGTGG + Intergenic
1021255978 7:18392782-18392804 TAGACTAGAAAGAACCAGCGAGG + Intronic
1025203588 7:56978254-56978276 TAGATTAGAAAAAACAGTGGTGG - Intergenic
1025668354 7:63598674-63598696 TAGATTAGAAAAAACAGTGGTGG + Intergenic
1028024893 7:85824558-85824580 TTGATTAGAAAGTACCTGTGAGG - Intergenic
1036125428 8:6057639-6057661 CAGATTAGGAAGGACCTGGTAGG - Intergenic
1045784676 8:105906740-105906762 TACATTAGAAAGTCCAGGGGAGG + Intergenic
1046312574 8:112457702-112457724 GAGATTAGAAAGGAATGAGGAGG - Intronic
1047921178 8:129636099-129636121 TAGCTGAGGAAGGACCAGGGTGG - Intergenic
1048381066 8:133865139-133865161 AAGATCACAAAGGACCGTGGAGG + Intergenic
1049973867 9:843155-843177 TAAATTAGAAAGGATCTTGGAGG + Intronic
1050830373 9:10003496-10003518 TAGATTAAAAAGGGCCGAGATGG + Intronic
1050845969 9:10219109-10219131 TAAATTAGAAAGGACTGACGGGG + Intronic
1053336603 9:37279265-37279287 TATATCAGAAAGGACTGGGATGG + Intronic
1056722120 9:89081613-89081635 TGAATTAGAAAGGACTAGGGGGG - Intronic
1196403010 X:115335412-115335434 TAGATTGGAAGGGCCCAGGGTGG - Intergenic
1201104142 Y:10750988-10751010 TAGATTAGAATGGAATGGAGTGG - Intergenic
1201213649 Y:11703209-11703231 TCGATTGGAAAGGACTGGTGTGG + Intergenic
1202607544 Y:26651819-26651841 TGGAGTAGAAAGGACTGGAGTGG + Intergenic