ID: 1084143790

View in Genome Browser
Species Human (GRCh38)
Location 11:67252360-67252382
Sequence TGCCATTTTAATACAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084143788_1084143790 3 Left 1084143788 11:67252334-67252356 CCTTATATACACTTCAGCAGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1084143790 11:67252360-67252382 TGCCATTTTAATACAGATGAAGG 0: 1
1: 0
2: 1
3: 23
4: 260
1084143787_1084143790 4 Left 1084143787 11:67252333-67252355 CCCTTATATACACTTCAGCAGGA 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1084143790 11:67252360-67252382 TGCCATTTTAATACAGATGAAGG 0: 1
1: 0
2: 1
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084143790 Original CRISPR TGCCATTTTAATACAGATGA AGG Intronic
900073427 1:791934-791956 TGCCCTTTTGATACAGAGGCTGG - Intergenic
900267559 1:1766231-1766253 TGTAATTTTAATAGAGATGGGGG - Intronic
901120933 1:6893105-6893127 TGCATTTTTAGTAGAGATGAGGG - Intronic
903389806 1:22955642-22955664 TTCCCTTATATTACAGATGAAGG - Intronic
905169924 1:36103755-36103777 TGCATTTTAAATAGAGATGAGGG + Intronic
907039140 1:51242451-51242473 TGGTATTTTAATAGAGATGGGGG - Intronic
907141597 1:52190970-52190992 TGCCACTGTACTACAGCTGAAGG - Intronic
908301726 1:62768352-62768374 TGCCATTTTAATAGATATTGTGG - Intergenic
910617269 1:89212861-89212883 TGCCCTTTTAAAAGAGCTGAAGG + Intergenic
911474260 1:98356983-98357005 TGTCCTATTAATACAGAGGAAGG - Intergenic
911474594 1:98359852-98359874 CGCCCTTTTAATACAATTGAGGG + Intergenic
911766773 1:101686195-101686217 TGGAATTTTAATAGAGATGGGGG + Intergenic
913262694 1:117014038-117014060 TGCCATCATTTTACAGATGAAGG - Intronic
913447227 1:118962465-118962487 TGTCATTTAAATACAGAAGGGGG - Intronic
914438933 1:147685610-147685632 TGCCCTTATAAAAGAGATGAAGG + Intergenic
918180016 1:182079294-182079316 TACTATTTTAAGACAGCTGATGG + Intergenic
918804878 1:189026427-189026449 TGACATTTTTAGAGAGATGAAGG + Intergenic
919431429 1:197497000-197497022 TGCCTTTTTAGTAGAGATGGGGG - Intergenic
922269295 1:224016843-224016865 TGCCCTTTTGATACAGAGGCTGG - Intergenic
923812043 1:237329466-237329488 TGTATTTTTAATACAGATGGGGG - Intronic
923828917 1:237531872-237531894 TATCATTTTTACACAGATGATGG - Intronic
924474991 1:244375113-244375135 TAACATTTTATTACAGATGCGGG + Intronic
924643457 1:245855764-245855786 TTCCATTTTAATCCAAATTATGG - Intronic
1063441136 10:6074250-6074272 TGCCTTTTTAAGACAAATAATGG + Intergenic
1065150627 10:22819209-22819231 AGACATTTTAACTCAGATGATGG - Intergenic
1065984187 10:30933158-30933180 TCCAATTTTAACACAGATGGTGG + Intronic
1067378114 10:45746948-45746970 TCCAATTTTAAAACAGAAGAGGG - Intronic
1067885813 10:50087623-50087645 TCCAATTTTAAAACAGAAGAGGG - Intronic
1068779513 10:60904352-60904374 TGCCATTTTGATCATGATGATGG - Intronic
1068878217 10:62020366-62020388 TGCCTTTTAAACACAGATGGGGG - Intronic
1069070615 10:63987634-63987656 TACCACTAGAATACAGATGAAGG + Intergenic
1069088733 10:64173752-64173774 TGCCCTTTTAAAAAAGATCATGG + Intergenic
1070406140 10:76098450-76098472 TGCCATTTAAATACAATTTAGGG + Intronic
1071040348 10:81301088-81301110 TGACATTTCATTACAGATGGAGG - Intergenic
1074654663 10:115571214-115571236 TGCCAATATAATACAGGTGCAGG - Intronic
1074706321 10:116135497-116135519 TGCCATCTTAATACACAGAAAGG - Intronic
1075634795 10:124023182-124023204 TGCCATTTTAATAAATGTCAGGG + Intronic
1076128040 10:127991807-127991829 TGCTATTCTAATAAAGATTATGG - Intronic
1076661617 10:132059370-132059392 TTCCATTTTATTGGAGATGAAGG + Intergenic
1077313541 11:1904679-1904701 TGCATTTTTAGTACAGATGGGGG + Intergenic
1079617052 11:22508280-22508302 TGGCATTTTAAAACAGTTGTTGG - Intergenic
1080192199 11:29564352-29564374 TGTCCTTTTATTGCAGATGAGGG + Intergenic
1081204909 11:40263662-40263684 TGGCATTTTAATAGAGACCATGG + Intronic
1081856326 11:46306205-46306227 TGCAATTTTAAGAAAGATTATGG - Intronic
1084143790 11:67252360-67252382 TGCCATTTTAATACAGATGAAGG + Intronic
1085560408 11:77467275-77467297 TGCCATGTGAACACAGAGGAAGG - Intronic
1086814929 11:91358468-91358490 TGGCAAATTAATACAAATGATGG - Intergenic
1087275635 11:96157982-96158004 TTCCATTTTAATTCAGTTCAAGG + Intronic
1087574248 11:99970792-99970814 TGAGATTTTAATAGAGATAAAGG + Intronic
1087958184 11:104315899-104315921 TGCATTTTTAGTAGAGATGAGGG + Intergenic
1088140542 11:106610790-106610812 TGCCATTTTAATAGGTATGTAGG + Intergenic
1089022351 11:115229365-115229387 TGCTATTTTAACAAATATGATGG + Intronic
1089596439 11:119583947-119583969 TGTATTTTTAATACAGATGGGGG - Intergenic
1093067165 12:14670274-14670296 TGTCATTTTGATACATATCAAGG + Intronic
1093861627 12:24173695-24173717 TAATATTTTAATACAGATGCTGG + Intergenic
1094035974 12:26072301-26072323 TGTCTTTTTGATACAGCTGATGG - Exonic
1094694162 12:32800188-32800210 TGCCACATGAACACAGATGAAGG - Intronic
1096869498 12:54584436-54584458 TGCCATGTTAATGCAGCTGGAGG + Intronic
1098237534 12:68431861-68431883 TACCATTTTAATAAGGATGAAGG + Intergenic
1098745022 12:74225120-74225142 GGCCATTTAAATAAAGATAATGG + Intergenic
1099133882 12:78868705-78868727 TACCATTTAAAGAAAGATGACGG + Intronic
1099450007 12:82797154-82797176 TGCCATTTTAAAAAACATAATGG + Intronic
1100396423 12:94189864-94189886 TGCGATTTCCACACAGATGATGG - Intronic
1100862840 12:98825003-98825025 TATCATTTTAATACAGAGGCAGG + Intronic
1102128565 12:110506056-110506078 TGTGTTTTTAATAGAGATGAGGG + Intronic
1104291775 12:127475879-127475901 TGCTATTTTAATACATGTGATGG + Intergenic
1107252951 13:38387820-38387842 TGCATTTTTAGTAGAGATGAGGG + Intergenic
1107934607 13:45334957-45334979 TGACATTTGAAAACAAATGAAGG - Exonic
1109160423 13:58966490-58966512 TGTCATTCTAATACATATTAGGG + Intergenic
1109950525 13:69497314-69497336 TTCCATATTAAGAAAGATGATGG - Intergenic
1111028617 13:82567706-82567728 TGCCATTAGAATAAAAATGATGG + Intergenic
1111196803 13:84885747-84885769 TTCAATTGTAATACAGTTGAAGG - Intergenic
1111921115 13:94412171-94412193 GGCTATTTTTATACAGCTGAAGG + Intergenic
1112677429 13:101719023-101719045 TTCCATTTTAATTCAGAACAAGG - Exonic
1113149003 13:107241429-107241451 TGCAATTTTAATAAAGTTAATGG + Intronic
1113739012 13:112698119-112698141 TGACATTTGAACACAGAGGACGG + Intronic
1114219913 14:20687089-20687111 AGTAATTTTAATACAAATGAAGG - Intronic
1114377735 14:22166810-22166832 TGCCCTTGCATTACAGATGAAGG - Intergenic
1116353639 14:43899159-43899181 AGCCATTTTAATGATGATGATGG + Intergenic
1116607416 14:47018917-47018939 TGCCATGTGAACACAGAGGACGG - Intronic
1116730423 14:48614054-48614076 TAGCATTTTAATACAGAATAAGG + Intergenic
1117293188 14:54353449-54353471 TGCCAGTGTAAGGCAGATGATGG - Intergenic
1117651716 14:57914664-57914686 TGCCATTGTAATAGTGCTGAGGG - Intronic
1119203772 14:72778694-72778716 TGCCATTTTAATACAGCAGCTGG + Intronic
1119227815 14:72957324-72957346 TACCAGTTGATTACAGATGATGG + Intronic
1119253731 14:73180156-73180178 TGCATTTTTAGTAGAGATGAGGG + Intronic
1120035511 14:79692443-79692465 TGCCATTAAAATACAGTTAAAGG + Intronic
1120098564 14:80418175-80418197 TGCCATTTTAAATCTGATGTGGG - Intergenic
1120404897 14:84082951-84082973 TGCCAATTTAATACAGAGGTAGG + Intergenic
1121437963 14:93931368-93931390 TGACATTTTAATACCGTTTATGG + Intergenic
1121567694 14:94923103-94923125 TGCCATGTGAATACAGGAGATGG - Intergenic
1122496222 14:102157655-102157677 TGTCATTTGAATTCAGATGGTGG + Intronic
1125394308 15:39230494-39230516 GGCAATTTTAATTCAGAAGATGG + Intergenic
1125810022 15:42530916-42530938 TGTCATTTTAATTCAGATGTTGG + Intronic
1127282633 15:57504920-57504942 TTCCTTTTTAAAACAGATGAGGG + Intronic
1127594686 15:60467951-60467973 TTCCATTTTAAAAAAAATGACGG + Intronic
1127721859 15:61709847-61709869 TGCATTTTTAATAGAGATGGGGG + Intergenic
1131235519 15:90693537-90693559 TGCCATTTTTTGACAGATAATGG - Intergenic
1133544166 16:6788828-6788850 TGCCATTTTAGGACATAAGATGG - Intronic
1138061616 16:53897266-53897288 TGAGATTTTTATACATATGAAGG - Intronic
1138812410 16:60166538-60166560 TGCCATATCAATACAGTAGATGG + Intergenic
1139312158 16:66036605-66036627 TTACATTCTAATAGAGATGAAGG - Intergenic
1140652482 16:77103569-77103591 TGACATTTTAATGCAGGTGATGG - Intergenic
1140675898 16:77329277-77329299 TAAAATTTTTATACAGATGAGGG + Intronic
1148900061 17:50868249-50868271 TGACATTTCAATGCAGAGGAAGG - Intergenic
1149885820 17:60339081-60339103 TGCATTTTTAGTACAGATGGGGG + Intronic
1150096418 17:62380173-62380195 TGTATTTTTAATAGAGATGAGGG + Intronic
1150206324 17:63411375-63411397 TTCCATTTTAAGACTGATGCTGG - Intronic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1152274286 17:79346093-79346115 TGCATTTTTAGTAGAGATGAGGG + Intronic
1153787421 18:8547019-8547041 TGCCATTTTTGTTCAGCTGAAGG + Intergenic
1154191661 18:12235547-12235569 TGCCATTTTAACAGAGAAAAGGG + Intergenic
1154334242 18:13453156-13453178 TGCCCTTTGAAAACAGATGATGG + Intronic
1154998306 18:21662276-21662298 TGCATTTTTAATAGAGATGGGGG + Intronic
1155138343 18:23018684-23018706 GTACATGTTAATACAGATGAAGG + Intronic
1155711073 18:28880039-28880061 TGTCATTATAATGAAGATGAGGG - Intergenic
1159033484 18:63255044-63255066 TGCCAGTTTGATTCCGATGAAGG + Intronic
1159133162 18:64304607-64304629 TACATTTTTAATACAGATTATGG - Intergenic
1161723811 19:5917346-5917368 TGCCATTTCAATTCAAAGGAGGG + Exonic
1161885118 19:6988601-6988623 TGCTATGTAAATGCAGATGATGG + Intergenic
1165705237 19:37971285-37971307 TGCCCTTTTAAAACATTTGATGG + Intronic
925600088 2:5599284-5599306 TGCCGCTTTCTTACAGATGAAGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
929061251 2:37926462-37926484 TGACATTTTAATATAGATTATGG - Intronic
930358459 2:50348001-50348023 TGCCATTGTAGTTCAGATGGAGG - Intronic
930518070 2:52432586-52432608 TACCTCTTTAACACAGATGAAGG + Intergenic
930749324 2:54917726-54917748 TGTGATCTTACTACAGATGACGG - Intronic
932578706 2:72978836-72978858 GGTGATTATAATACAGATGAAGG + Intronic
933373501 2:81447726-81447748 TGCCATTATAATAAATATTAAGG + Intergenic
937107632 2:119332903-119332925 TACATTTTTAGTACAGATGAGGG + Intronic
937728980 2:125204179-125204201 TGCCAATATAATGCAAATGATGG + Intergenic
940122079 2:150278166-150278188 TTGCACTTTAATACAGATAAAGG - Intergenic
940715975 2:157224194-157224216 TCCCATTTAACTACTGATGATGG + Intergenic
941087638 2:161136189-161136211 TTCCTTTTTATTACAGATGAGGG - Intergenic
941797858 2:169620788-169620810 TACTATTTTATTACAGATAATGG + Intronic
941865138 2:170326583-170326605 TGCCATGTCAATAGAGATGATGG - Intronic
944003155 2:194866961-194866983 TGCCAAGTAAATACAGATGCAGG + Intergenic
946684414 2:222253046-222253068 GGCCATTTAGATAGAGATGATGG - Intronic
947897433 2:233688769-233688791 TGCCATTCTAATGGAGAGGAAGG + Intronic
1172635183 20:36405576-36405598 TGCTATTTTAATAATGATGGTGG + Intronic
1173304278 20:41833111-41833133 TGCCATGTTAATACAGGTCCAGG - Intergenic
1173970609 20:47149453-47149475 TGCCATTTTAACCAAGAGGATGG - Intronic
1174590710 20:51642456-51642478 TTTCATTTTAAAACAGATGCTGG - Intronic
1175850744 20:62091030-62091052 TGTGTTTTTAGTACAGATGAGGG + Intergenic
1177557739 21:22714284-22714306 TCCCATTTTAATAAAATTGATGG - Intergenic
1177879359 21:26673719-26673741 TTCCATTTTAAGTCAGAGGATGG + Intergenic
1179907108 21:44428244-44428266 TGAGACTTTAATACAGCTGAAGG + Intronic
1184096102 22:42317413-42317435 TTCGATTTAAACACAGATGACGG + Intronic
1184270337 22:43377596-43377618 TTCCATTTTAAGAAAGATGAGGG + Intergenic
949533126 3:4977096-4977118 TGTGATTTTAATAAGGATGAAGG - Intergenic
951027632 3:17846411-17846433 TGGCAATTTAATAAAGATGATGG - Intronic
953577584 3:44125657-44125679 AGCCATGGTAATCCAGATGATGG + Intergenic
954250182 3:49361428-49361450 TGCCTTTTTAAAAGTGATGATGG - Intronic
954705116 3:52475962-52475984 TGCATTTTTAATAGAGATGGGGG - Intronic
954982322 3:54757529-54757551 TGCTATTTTAAGAGAGGTGAAGG + Intronic
956253192 3:67255851-67255873 TGCCATTCTAACACATAAGATGG - Intergenic
956276771 3:67510557-67510579 TGCTTTTTTAAGACAGATGAAGG - Intronic
956686282 3:71831195-71831217 TGAAATTTTGATACAGATCATGG + Intergenic
959757853 3:109920591-109920613 TTCAATATTAATATAGATGAAGG + Intergenic
960767720 3:121155090-121155112 TATCATTTTAAAACAGATTATGG + Intronic
962087968 3:132211638-132211660 TGCATTTTTATTAGAGATGAGGG + Intronic
962347804 3:134632941-134632963 TATTATTTTAATACATATGAGGG - Intronic
963963669 3:151340309-151340331 TGAGATTTAAATACAGATAAAGG - Intronic
964538462 3:157752620-157752642 TGGCATGTTAATAGAGATAAAGG + Intergenic
966179658 3:177176638-177176660 TGTGTTTTTAATAGAGATGAGGG - Intronic
966592936 3:181701434-181701456 CGCTATTTAAATACAGGTGAAGG + Intergenic
968407748 4:356055-356077 TGTCATTTTAGTAGAGATGGGGG - Intronic
970040451 4:11791316-11791338 TGCTATTCTAATATATATGATGG + Intergenic
971197189 4:24480789-24480811 TGCCATTTGAAGACAGATGATGG + Intergenic
971916137 4:32872169-32872191 TGTCATTTTTATTCAGGTGAGGG + Intergenic
972932456 4:44090311-44090333 TGCCATTTGAATACTGAGCATGG + Intergenic
973584481 4:52376851-52376873 TGACATTTTAATACACATTAAGG - Intergenic
974079492 4:57197452-57197474 TAGCATTTTCCTACAGATGAAGG - Intergenic
976920405 4:90434338-90434360 TGCCATTTTAAAACAGGGCAGGG - Intronic
979320583 4:119319284-119319306 AGCCATTTTAAAACACATGTTGG + Intronic
979777420 4:124608191-124608213 TGATATTTAACTACAGATGAGGG + Intergenic
979960752 4:127018546-127018568 TTCCAAACTAATACAGATGATGG + Intergenic
980967690 4:139538820-139538842 TTCCAGTTTGATTCAGATGATGG - Intronic
981303420 4:143217560-143217582 TACCATTTTAGTACATATCAGGG + Intronic
981319311 4:143373172-143373194 TGACATTTTAATAGAGATGCTGG - Intronic
982964481 4:161886665-161886687 TGACTTTCTAATACAGATAAAGG - Intronic
983378667 4:166962439-166962461 TTCTAGTTTAAAACAGATGATGG - Intronic
983732214 4:171009970-171009992 CGCCATTTTAACACATGTGAAGG - Intergenic
985971061 5:3378989-3379011 TGCCATTTTATCACAGATGTAGG + Intergenic
988219127 5:28318481-28318503 TGCAATTTTATTGCAGATCAGGG - Intergenic
989402198 5:41020401-41020423 TGCCATGTTAACAAAAATGAGGG - Intronic
990530554 5:56669458-56669480 TGTCAATTCAAAACAGATGAAGG + Intergenic
991278148 5:64876246-64876268 TATAATTTTAATACATATGATGG + Intronic
993189795 5:84667740-84667762 TGCTCTTGTAATACACATGAAGG + Intergenic
994329460 5:98488608-98488630 GGCAATTTTTATACAGATGGGGG + Intergenic
994572652 5:101534267-101534289 TGTGATTTTGATACAGATGTCGG + Intergenic
995754419 5:115487327-115487349 TGCAGTTTTAATAAAGATGAAGG + Intergenic
996020399 5:118584997-118585019 TGCATTTTTAAAACAGATGATGG + Intergenic
996037478 5:118774485-118774507 TGCCTTTTGAATACAAAGGAAGG - Intergenic
996185511 5:120469045-120469067 TGCCATTGTAAGACAAATTATGG - Intronic
1003699635 6:8447400-8447422 TTGCATTTTAATAGAGATGGGGG + Intergenic
1004476542 6:15978705-15978727 TACAAATTAAATACAGATGATGG + Intergenic
1005006377 6:21291210-21291232 TGTATTTTTAATAGAGATGATGG + Intergenic
1005499168 6:26414857-26414879 TGTACTTTTAGTACAGATGAGGG + Exonic
1005777959 6:29158352-29158374 TGCCATTTTAATTTATATGCGGG + Intergenic
1007116985 6:39349817-39349839 TGTCTTTTTAGTAGAGATGAGGG + Intronic
1008723054 6:54380877-54380899 TGCCATATAAATATATATGAGGG - Intronic
1009848617 6:69166178-69166200 TGCAATCTCAATACAGAAGAGGG + Intronic
1011269791 6:85566251-85566273 TGCCATTTAACTAAAGCTGATGG - Intronic
1011912797 6:92463981-92464003 TGATATTTTAATAAATATGAAGG - Intergenic
1011995199 6:93577902-93577924 TGATATTGTAATACAGATAAAGG + Intergenic
1014532207 6:122571755-122571777 TTCCATTTTGATATAGATCAAGG - Intronic
1016347501 6:143130102-143130124 TGCACTTTTAATAGAGATGGGGG + Intronic
1017261386 6:152391689-152391711 TGCCTTTTAAATAAAGATGCTGG + Intronic
1020172380 7:5855242-5855264 TGCATTTTTAATAGAGATGGGGG + Intergenic
1020175350 7:5877644-5877666 TGCATTTTTAGTAGAGATGAGGG - Intergenic
1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG + Intronic
1021394917 7:20135469-20135491 TTCCATTTCTATAGAGATGAAGG + Exonic
1022832250 7:34079464-34079486 TGCTATTTTTAGACAGAGGATGG - Intronic
1022916712 7:34963019-34963041 TGTATTTTTAATAGAGATGAGGG - Intronic
1023277365 7:38534365-38534387 GACCACTGTAATACAGATGACGG - Intronic
1023431595 7:40098036-40098058 TGCAATTTAGATACAGCTGAGGG - Intergenic
1023483502 7:40660007-40660029 TTCCATTATAAGACACATGATGG + Intronic
1023616111 7:42021784-42021806 TGCCATTATAGAACAGATGTTGG - Intronic
1025094502 7:56087013-56087035 TTCCATTTCAGTACAGCTGAAGG - Exonic
1025188091 7:56876532-56876554 TTCCATTTCAGTACAGCTGAGGG - Intergenic
1025683832 7:63700390-63700412 TTCCATTTCAGTACAGCTGAGGG + Intergenic
1027712329 7:81620747-81620769 TGCCATCTTAATATATATGATGG - Intergenic
1027832475 7:83197300-83197322 TGTTATTTTAATACAAAGGAAGG - Intergenic
1029843133 7:103386933-103386955 TGTAATTTTAGTAGAGATGAGGG + Intronic
1031218338 7:118927726-118927748 TGCCATTTAAATCAAGTTGATGG - Intergenic
1032882623 7:136105254-136105276 TACCACCTTATTACAGATGAGGG - Intergenic
1033816961 7:145085054-145085076 AGCCATATCAATACTGATGAAGG - Intergenic
1033896929 7:146083590-146083612 TCCCATATTTTTACAGATGAAGG + Intergenic
1036187204 8:6633691-6633713 TGCCATTTTATTACACATTGTGG - Intronic
1037336682 8:17799164-17799186 TGCCCTTGAAATACAGTTGATGG - Intronic
1038120671 8:24611091-24611113 TGTATTTTTAGTACAGATGAGGG - Intergenic
1038886364 8:31667270-31667292 TCCCAATCTAATACAGAAGATGG + Intronic
1039993373 8:42509000-42509022 TCCCATTTTAAAAGTGATGAAGG - Intronic
1040455083 8:47589344-47589366 TGCATTTTTAATAGAGATGGGGG - Intronic
1040506442 8:48053068-48053090 GGCTAATTTAATACAGATGGGGG + Intronic
1043846875 8:85173679-85173701 TGCCATTTTTATAGAGATTCAGG - Intergenic
1045258380 8:100549377-100549399 TGCCATTCTAATATAAATCAGGG + Intronic
1045551110 8:103173296-103173318 AGTCATTTAAATACAGAAGAGGG - Intronic
1047802576 8:128325345-128325367 TTCCATCTTAATTCAGAAGAAGG - Intergenic
1048465646 8:134662714-134662736 TGTAATTTTAATATAGATGCTGG - Intronic
1048656173 8:136539147-136539169 TGGCATTTTAGTACAAATCAAGG - Intergenic
1049015444 8:139916797-139916819 TGACATTTAAATACAAATCAAGG + Intronic
1054714228 9:68541259-68541281 TGCCTTTTTAGTACAGAAAAAGG - Intergenic
1054827717 9:69589873-69589895 TGCAATTTTAAGAGAAATGATGG + Intronic
1055248831 9:74278131-74278153 TGTCCTTTTAAAAGAGATGATGG - Intergenic
1055459181 9:76501384-76501406 TGGAATTTGAATATAGATGAAGG + Intronic
1055484450 9:76743930-76743952 TGCAATTTAAAAACAGATAAAGG + Intronic
1055848518 9:80596005-80596027 GGCCCTATTAATAAAGATGATGG + Intergenic
1057338443 9:94177086-94177108 TTCAATTTTAATACCCATGAAGG + Intergenic
1057389550 9:94631331-94631353 AGTCATTTTAATTCATATGATGG + Intronic
1058365964 9:104208713-104208735 TGCATTTTTAATAGAGATGGGGG + Intergenic
1059018986 9:110552903-110552925 TGCAATTTTAAGACACCTGAAGG + Intronic
1059070195 9:111127424-111127446 TGCAGTTTTAATAGAGATGGGGG - Intergenic
1059751030 9:117247473-117247495 TGCCCTCTTATTACAAATGAAGG - Intronic
1060092640 9:120757220-120757242 TGCCAATTTAATAGATATAAAGG - Exonic
1062457663 9:136647051-136647073 TGGCACTTTAAGACAGATGCCGG - Intergenic
1185473866 X:401830-401852 TGCTAATTTAATACAGAAGAAGG - Intergenic
1186432012 X:9513054-9513076 TGCATTTTGAATACAAATGAAGG + Intronic
1187160504 X:16760723-16760745 TTCCATTTTAATTGATATGAGGG + Exonic
1188072932 X:25739769-25739791 TGCAAATTTATTCCAGATGAGGG - Intergenic
1188074853 X:25762607-25762629 TTCCAATTTAATACAGAAGGTGG - Intergenic
1188255608 X:27959222-27959244 TGGCATTTTGGTATAGATGATGG + Intergenic
1188461135 X:30428713-30428735 GGCCTTTTTAATACAGTTTATGG + Intergenic
1188538578 X:31224190-31224212 AGCTGTTTTAATACAGATCATGG + Intronic
1189433960 X:40974667-40974689 TGGTATTTTAATACATCTGATGG + Intergenic
1189607222 X:42692341-42692363 TGCTTTGCTAATACAGATGATGG - Intergenic
1190021566 X:46882923-46882945 TGAATTTTTAATAGAGATGATGG + Intergenic
1190163292 X:48049795-48049817 GACTATTTTAATACAGATGGAGG + Intronic
1190384976 X:49876659-49876681 TACATTTTTAAAACAGATGATGG + Intergenic
1190820712 X:53969059-53969081 TGCATTTTTAGTAGAGATGAGGG - Intronic
1191644584 X:63466789-63466811 TGCCATTAGAATAAAGATAAGGG + Intergenic
1193658181 X:84224179-84224201 TCCCATATTAATAGAGATTATGG + Intergenic
1193825938 X:86227252-86227274 TGCCTTTTTACTACCGATTAGGG + Intronic
1194670932 X:96731355-96731377 GGCCATTACAATAGAGATGAAGG - Intronic
1194736419 X:97517277-97517299 TGTCATTTTTATACAGGTGATGG + Intronic
1194841075 X:98742842-98742864 TTCTATTTTATTACAGATGGGGG - Intergenic
1195330316 X:103792518-103792540 TGCAATTTTAACACACATAAAGG + Exonic
1196526208 X:116729464-116729486 TGCCATTTTAATTCAGAATTTGG - Intergenic
1198298377 X:135309326-135309348 TGGCATTTCAAATCAGATGATGG + Intronic
1198300513 X:135330183-135330205 TGGCATTTTAAATCAGATCATGG + Intronic
1198307454 X:135397219-135397241 TGGCATTTCAAATCAGATGATGG + Intergenic
1198743488 X:139866043-139866065 TCCCATTTTAAAACAGAAAAGGG + Intronic
1199328924 X:146536008-146536030 TGCATTTTTAATACAGACGGGGG - Intergenic
1201075784 Y:10187361-10187383 TGCCTTTTTGAGACAGTTGAGGG - Intergenic