ID: 1084144368

View in Genome Browser
Species Human (GRCh38)
Location 11:67256278-67256300
Sequence GTTCAATGCAAAGTAAAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084144368_1084144375 5 Left 1084144368 11:67256278-67256300 CCCCCTTTTACTTTGCATTGAAC 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1084144375 11:67256306-67256328 GTCCAAAGATCCTCTCTCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 118
1084144368_1084144374 4 Left 1084144368 11:67256278-67256300 CCCCCTTTTACTTTGCATTGAAC 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1084144374 11:67256305-67256327 TGTCCAAAGATCCTCTCTCTAGG 0: 1
1: 0
2: 1
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084144368 Original CRISPR GTTCAATGCAAAGTAAAAGG GGG (reversed) Exonic
902694114 1:18128865-18128887 GTTCAAGGTGAAATAAAAGGAGG - Intronic
902810130 1:18883347-18883369 GTTCAATGCCAAGTATGCGGTGG - Exonic
904065971 1:27751401-27751423 TTTCAAAGCAAAGTAAATGCAGG - Intronic
904362191 1:29983494-29983516 GTTCAGATCAATGTAAAAGGAGG - Intergenic
907207813 1:52790017-52790039 GGTCACTGCAAAGTGAAAGGAGG - Exonic
908899831 1:68943908-68943930 GAGCAATGCAAATTAAAAGATGG + Intergenic
910498683 1:87863542-87863564 GTGCAATGAAAAGTGAATGGAGG - Intergenic
911661174 1:100503043-100503065 TTTCTAAGCAAAGTTAAAGGGGG - Intronic
912074258 1:105851993-105852015 GTGCAAGGCAAAGTAAGAGCAGG - Intergenic
912724833 1:112049900-112049922 GGACATTGCAAAGGAAAAGGAGG - Intergenic
913310381 1:117484608-117484630 GTTCACTGCATAGCAAAAAGAGG + Intronic
916204816 1:162306248-162306270 CTTCACTGCAAACTCAAAGGTGG - Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920693122 1:208161912-208161934 ATTGAATCCACAGTAAAAGGAGG + Intronic
921914189 1:220588410-220588432 ATTCATTGCAAAGTAATAGAAGG - Intronic
921938885 1:220819475-220819497 GTCCAATGCAAAATCAGAGGGGG - Exonic
1066556937 10:36624654-36624676 ATAAAATGCAAAGTAAAAGAAGG - Intergenic
1067277466 10:44848094-44848116 CTTCAAAGAAAAGTAAAAAGTGG + Intergenic
1069170454 10:65221859-65221881 TTTCAATTTAAAGTAAATGGTGG + Intergenic
1069393474 10:67962712-67962734 TTTAAAAGCAAAGTTAAAGGAGG + Intronic
1070616865 10:77975964-77975986 GCTCAATTCAAAGATAAAGGGGG + Exonic
1075285853 10:121185296-121185318 GTCCAATGTAAAGGAAAGGGTGG + Intergenic
1078411104 11:11119511-11119533 CGGAAATGCAAAGTAAAAGGAGG - Intergenic
1079015473 11:16865230-16865252 GTACAATGCATAGAGAAAGGGGG - Intronic
1084144368 11:67256278-67256300 GTTCAATGCAAAGTAAAAGGGGG - Exonic
1088305207 11:108400332-108400354 GATAAATGCACACTAAAAGGAGG - Intronic
1095810213 12:46366459-46366481 GTTCAATGCAAAATACAGGCTGG - Intronic
1098116909 12:67188649-67188671 GTTCAATGCAAATGAAAAGCAGG - Intergenic
1099480482 12:83159623-83159645 GTTCATTGCAATGAAAAAGTGGG + Intergenic
1105405775 13:20131430-20131452 GTTCAAAGCAAATTAAAGAGGGG - Intergenic
1106069476 13:26394513-26394535 GTACAATGCAAACTCCAAGGGGG - Intronic
1106283447 13:28297747-28297769 GATCAATGCAATGTGAAAGAAGG - Intergenic
1110500128 13:76217691-76217713 ATCCAATGCAAAGTAAAATAAGG + Intergenic
1111712728 13:91837760-91837782 CTTCACTGCAAAGTAGAAGCTGG + Intronic
1113033496 13:106021255-106021277 GCTCATTGCAAAGAAAAAGCAGG - Intergenic
1114262601 14:21048963-21048985 GTTGAAGGAGAAGTAAAAGGGGG + Intronic
1114367592 14:22046541-22046563 GTTAAAATCAAAGAAAAAGGAGG + Intergenic
1115658185 14:35464304-35464326 TTTCAATTCATAGTAAAAAGGGG + Intergenic
1116113343 14:40615241-40615263 GTCCATTGCAAAGTAATATGAGG - Intergenic
1118748918 14:68792871-68792893 GTTTTATGCAAGGTAAAGGGGGG - Exonic
1129011250 15:72419677-72419699 ACTCTATGCAAAGAAAAAGGAGG + Intergenic
1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG + Intronic
1131745511 15:95443078-95443100 GTTCATTCCAAAGTTAACGGAGG + Intergenic
1138937691 16:61749706-61749728 GTTCAGAGCAAAATAAAACGGGG - Intronic
1140259925 16:73369295-73369317 GTCCATTGCAAAGTAAAATGTGG + Intergenic
1140658909 16:77168390-77168412 GTTCAATGGAAAGAAAACTGAGG + Intergenic
1149116402 17:53102118-53102140 GCTTAAGGCAAAATAAAAGGAGG - Intergenic
1150044841 17:61902342-61902364 GTCCAATTCCAAATAAAAGGAGG - Intronic
1156998059 18:43492562-43492584 GTTAAATGTAAAGGAAAAGCAGG + Intergenic
1159568808 18:70088354-70088376 TTTCAAAGCAAAGTAAAACTGGG + Intronic
1162293841 19:9799209-9799231 GTGCAATGCAAAGTCATAGAAGG - Intergenic
1166512672 19:43420157-43420179 GTATAGAGCAAAGTAAAAGGTGG + Intergenic
1168562203 19:57393852-57393874 GTTCAATGCAAATGAAAGAGTGG - Intronic
925511755 2:4635147-4635169 GGTCAAGGAAAAGTAAAATGTGG - Intergenic
926492345 2:13540068-13540090 GTCCTATGCATAGTAATAGGTGG - Intergenic
928648440 2:33379708-33379730 CATCACTGCAAAGTAAAAGATGG - Intronic
931609400 2:64082246-64082268 GGTAAATGGAGAGTAAAAGGAGG - Intergenic
931859232 2:66336344-66336366 GCTCAATGCAAAGCACAAAGAGG - Intergenic
932784272 2:74586258-74586280 TTTAAATGTAAATTAAAAGGTGG + Intronic
933432994 2:82208808-82208830 GTACAATGCTGAGTAGAAGGAGG + Intergenic
934995328 2:98952528-98952550 TGTAAATGCACAGTAAAAGGTGG - Intergenic
935895774 2:107735984-107736006 GATAAATGCAAAGTGAAATGTGG - Intergenic
936580461 2:113695828-113695850 GTTCAATGAAAAGAAAAACAAGG - Intergenic
937479565 2:122244222-122244244 GTTGAAGGCAAAATAAATGGAGG + Intergenic
937764644 2:125645926-125645948 AATCAATTAAAAGTAAAAGGAGG - Intergenic
939735084 2:145834054-145834076 GCTCAAGGCAAATTAAAATGAGG - Intergenic
941332580 2:164196881-164196903 CTTTAACCCAAAGTAAAAGGAGG - Intergenic
941416024 2:165222692-165222714 GTACAATGTAACATAAAAGGAGG + Intergenic
942712788 2:178856403-178856425 GTTCAATAAAAAGAAATAGGTGG + Intronic
944557540 2:200902854-200902876 GATCACTGCCAAGTAAAATGAGG - Intronic
945208138 2:207354103-207354125 CATCAAAGCAAAGAAAAAGGAGG - Intergenic
945740504 2:213654739-213654761 TTTCAATGTAAAGGAAAAAGAGG + Intronic
945867338 2:215191047-215191069 GTTCAATGAAAGATAAATGGTGG + Intergenic
946827879 2:223697320-223697342 TTACAATGCTAAGTAAAATGTGG - Intergenic
1170618874 20:17977423-17977445 CTGCAGTGCAAAGTAAAAGCAGG + Intronic
1170689434 20:18599734-18599756 GGTAAATGCAAATTAAAATGAGG - Intronic
1170789396 20:19495285-19495307 GTCCAATGCAAAGTACAGGCAGG - Intronic
1172827300 20:37800389-37800411 GTGGAGTGAAAAGTAAAAGGAGG - Intronic
1173699193 20:45052504-45052526 GTTAAATGCCAAGTAAAAAGAGG - Intronic
1179072199 21:38082123-38082145 GTTCTCTGCAAAACAAAAGGCGG - Intronic
1182162892 22:28140919-28140941 TTTAAATGCAAAGGAAGAGGAGG + Intronic
1184889981 22:47373713-47373735 GGTCAAAGCAAAGAAAAAGAGGG - Intergenic
949467410 3:4357988-4358010 GTTCAAAAAAAAGTAAAAGGTGG + Intronic
949916031 3:8965341-8965363 GTTCCATGTAAAATAAAAGCAGG + Intergenic
951484796 3:23200005-23200027 GTACACTGCAAAGTATCAGGGGG - Intergenic
956880572 3:73507079-73507101 GAACACTGCAAAGTAAAAGTAGG + Intronic
957153895 3:76521675-76521697 ATTCATTGCAAAGTAAAGGCTGG + Intronic
957938619 3:86976145-86976167 ATGAAATGCAAAGTAATAGGTGG - Intronic
958779818 3:98526889-98526911 GTAGATTGCAAAGGAAAAGGAGG + Intronic
959837545 3:110938003-110938025 TGTCTAGGCAAAGTAAAAGGGGG + Intergenic
964493445 3:157262108-157262130 TTTCATTGCAAAGTGAAAGGAGG - Intronic
966140376 3:176750258-176750280 GTTCCACGCAAAGCAAATGGAGG + Intergenic
968266074 3:197364374-197364396 CTTCAATGCAATGTAAGAGTGGG - Intergenic
969388876 4:6875787-6875809 GCACAGTGCAGAGTAAAAGGAGG - Intronic
970842603 4:20492343-20492365 GTTCAATGCAAAGTGAAGAAAGG + Intronic
970931227 4:21514665-21514687 GAAAAATTCAAAGTAAAAGGAGG + Intronic
974664730 4:64945032-64945054 GTTCAAGACAAAGTATAAGCAGG - Intergenic
974675398 4:65081247-65081269 ATTCAATGTAAAATAAAGGGAGG + Intergenic
976485020 4:85591726-85591748 CTTCATTGCAAGGGAAAAGGAGG + Intronic
977118458 4:93065049-93065071 TTTCAATACAAAGTAAAAACGGG + Intronic
980796768 4:137695596-137695618 GTTCTATGCTAAGTAAAAAGGGG + Intergenic
981321038 4:143391566-143391588 TTTCAAAGCACAGAAAAAGGCGG + Intronic
981440416 4:144775927-144775949 GTTCACTGGAAACTAAAATGGGG + Intergenic
982127423 4:152196462-152196484 GTTCATTAAAAAGTGAAAGGGGG - Intergenic
982614985 4:157629490-157629512 ATTCAATGCACAGTAAAAACAGG + Intergenic
985563595 5:604141-604163 GTTCAGCGCAAAGGAGAAGGGGG + Intergenic
986258001 5:6117229-6117251 TTTCAAAGCTAAGTAAAGGGAGG - Intergenic
987434558 5:17878532-17878554 TTTCCATCCAAAGTAAAATGTGG - Intergenic
988669793 5:33369148-33369170 CTTCAATGCACAATAAAATGAGG + Intergenic
988673811 5:33410422-33410444 GTTCCATGCACAGTAAATAGTGG + Intergenic
988868565 5:35362171-35362193 GTTCAAATCAAAGTCAAAGCTGG - Intergenic
988961771 5:36378166-36378188 GTTCCATGCACAAAAAAAGGGGG + Intergenic
989661108 5:43798383-43798405 GTTAACTGCAAAGTCACAGGGGG + Intergenic
990487448 5:56273256-56273278 GTTGACTGCAAAGTAAAAAAAGG + Intergenic
992768127 5:80021815-80021837 GTTGAATGAAAAGTACAATGAGG - Intronic
993392708 5:87340615-87340637 GTTCAAAACATAGTAAAAGGGGG + Intronic
993778334 5:92031322-92031344 GATCAATGCAAAGCAAATTGTGG - Intergenic
994278853 5:97875730-97875752 GTTTGAGGCAAAATAAAAGGTGG + Intergenic
995170850 5:109110006-109110028 GAAAAATGCAAAGTTAAAGGCGG + Intronic
995189872 5:109308850-109308872 GATCAATGAGAAGCAAAAGGAGG - Intergenic
996829298 5:127721791-127721813 GTACAAGGCAAAGGAGAAGGAGG + Intergenic
997065370 5:130553528-130553550 ATTGCATGCAAATTAAAAGGTGG - Intergenic
997590925 5:135071723-135071745 GTTCAATGAAAAACAAATGGTGG + Intronic
999915817 5:156258385-156258407 AATGAATTCAAAGTAAAAGGAGG + Intronic
1002126219 5:177046489-177046511 ATTAAATGAAAAGTAAAAGCGGG - Intronic
1003802194 6:9682589-9682611 GTACAATGCAATGTGGAAGGAGG - Intronic
1006728582 6:36218053-36218075 GCTGAATGGAGAGTAAAAGGAGG - Intronic
1009030055 6:58045932-58045954 TTTCAATGAAATGTAAAAAGTGG - Intergenic
1009913177 6:69959530-69959552 GGTCATTGCACAGTAATAGGTGG - Intronic
1012426151 6:99116926-99116948 GATAAGTGCAAAGTAAAATGGGG - Intergenic
1012950464 6:105512747-105512769 TTCCAATGCAAAGTAGAAAGGGG + Intergenic
1013952510 6:115801354-115801376 CTTCAATGAAAAGCAAATGGAGG + Intergenic
1015428803 6:133105401-133105423 GTTCAGTGCAAAAGAAAAGGAGG + Intergenic
1016647107 6:146423407-146423429 CTTCAATGCAAAGTGAAAGTCGG + Intronic
1016926291 6:149352179-149352201 GTGCCATACAAAGTAAATGGTGG - Intronic
1017142105 6:151200525-151200547 GTCAAATCAAAAGTAAAAGGTGG + Intergenic
1020419311 7:7983020-7983042 GTTTAATACAAAGTACAACGGGG - Intronic
1021051098 7:15986062-15986084 GTTAAATGGAAAGCAAAATGTGG + Intergenic
1021081961 7:16375118-16375140 GAACATGGCAAAGTAAAAGGAGG - Intronic
1021385905 7:20029678-20029700 ATTCAAAGCAGAGTAAAAAGAGG - Intergenic
1022175682 7:27869816-27869838 TTTCTGTGCAAAGTAAAGGGAGG + Intronic
1022761211 7:33354124-33354146 TTTCAATACAAAGTGAAAGCTGG + Intronic
1023189049 7:37559592-37559614 TTTTAATGGAAAGTGAAAGGAGG - Intergenic
1023895856 7:44432336-44432358 GTAAAATGAAGAGTAAAAGGAGG + Intronic
1024350651 7:48359475-48359497 GTTCCATGAAAAGGAAAGGGAGG + Intronic
1026270553 7:68832853-68832875 GGACAATTCAAAGTAAAAGTAGG + Intergenic
1026445256 7:70479056-70479078 GTTAAGTGCAGAGAAAAAGGAGG + Intronic
1026992086 7:74592405-74592427 GTGCAATACAAAAAAAAAGGGGG - Intronic
1027550722 7:79590939-79590961 GTGCTTTGCAAAATAAAAGGGGG - Intergenic
1030830731 7:114217573-114217595 GTGTAATCCAAATTAAAAGGAGG + Intronic
1034018672 7:147615832-147615854 TTTCAATGTTAAGTAAAATGAGG - Intronic
1034359726 7:150483859-150483881 TTTCAATGTAATGTAGAAGGGGG - Intergenic
1037059641 8:14491050-14491072 ATTCAAGGCCAAGTAAAATGAGG - Intronic
1037305066 8:17496716-17496738 GTAGAATGGAAAGTAAACGGGGG + Intergenic
1037521948 8:19688583-19688605 AGTCAATGCAAAGTATAAGGTGG - Intronic
1039965414 8:42280412-42280434 GTTAAATACAAAGGAAGAGGAGG + Intronic
1040455295 8:47592071-47592093 ATTAAATGCAAACAAAAAGGAGG + Intronic
1041372671 8:57179466-57179488 GTTTAAAATAAAGTAAAAGGTGG + Intergenic
1045168342 8:99632806-99632828 GATCTATACAAAGTAAAGGGTGG + Intronic
1045368865 8:101501211-101501233 GTTCATTACAAAGTAAAATAAGG - Intronic
1046668027 8:117026561-117026583 AATCACTGCAAAATAAAAGGAGG - Intronic
1047355294 8:124115521-124115543 AATCAATGCAAAGAAAAAGGAGG - Intronic
1049109466 8:140634576-140634598 TTTAAATGCAGAGTAGAAGGCGG - Intronic
1052095691 9:24381022-24381044 CTTCAGTGCAAAATAAAAGTGGG + Intergenic
1052291195 9:26843346-26843368 ATTCAATGCCAAGAACAAGGTGG - Intronic
1055142248 9:72888913-72888935 GTACAATTTAAAGAAAAAGGTGG - Intergenic
1060008925 9:120026390-120026412 GTTCAATGCAATGGCCAAGGAGG + Intergenic
1060325260 9:122608517-122608539 GGCCAATGCAATGTAAAAGTAGG - Intergenic
1186295936 X:8148490-8148512 CTTCAACACAAAGTAAAAAGAGG - Intergenic
1187176344 X:16899344-16899366 GTTTAATACAAATTAAAAAGCGG + Intergenic
1191659801 X:63637493-63637515 CCTCAATGGAAAGTAAAAGAGGG + Exonic
1192067042 X:67896342-67896364 GTGAACTGCAAAGTTAAAGGTGG - Intergenic
1192332458 X:70187391-70187413 GTGGAATGCAAAGAACAAGGTGG + Intronic
1196344459 X:114636798-114636820 GTTGAATGAAAACTAAAAGTAGG + Intronic
1200302481 X:154991487-154991509 GTTCAATGGGAAATAAAGGGTGG + Intronic
1201600331 Y:15721361-15721383 GTTCAATTCAGAGTAGAAGTTGG - Intergenic