ID: 1084145132

View in Genome Browser
Species Human (GRCh38)
Location 11:67261263-67261285
Sequence GGCCTCACTGGATTGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084145132_1084145137 11 Left 1084145132 11:67261263-67261285 CCTCAAAACAATCCAGTGAGGCC No data
Right 1084145137 11:67261297-67261319 GCCCTTTGTACAGATGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084145132 Original CRISPR GGCCTCACTGGATTGTTTTG AGG (reversed) Intergenic