ID: 1084145720

View in Genome Browser
Species Human (GRCh38)
Location 11:67264219-67264241
Sequence TAGGGGCACCAGTGACAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084145708_1084145720 23 Left 1084145708 11:67264173-67264195 CCTTTGAGTCGGGTCCTGTGGTG No data
Right 1084145720 11:67264219-67264241 TAGGGGCACCAGTGACAGTGGGG No data
1084145713_1084145720 9 Left 1084145713 11:67264187-67264209 CCTGTGGTGGGCACTGGGAGCAA No data
Right 1084145720 11:67264219-67264241 TAGGGGCACCAGTGACAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084145720 Original CRISPR TAGGGGCACCAGTGACAGTG GGG Intergenic
No off target data available for this crispr