ID: 1084146159

View in Genome Browser
Species Human (GRCh38)
Location 11:67266462-67266484
Sequence GCCCCGACTGCAGTCCCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084146151_1084146159 13 Left 1084146151 11:67266426-67266448 CCGGGGCGCGGGCGCGCGGGCGG 0: 1
1: 1
2: 13
3: 109
4: 612
Right 1084146159 11:67266462-67266484 GCCCCGACTGCAGTCCCGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084146159 Original CRISPR GCCCCGACTGCAGTCCCGGC GGG Exonic
900279239 1:1855276-1855298 GCCCCCACTGCACTCCAGCCTGG + Intronic
900283877 1:1890405-1890427 GCCCCGCCTGCAGGCCCGCCCGG + Intronic
900421501 1:2557817-2557839 GCCCCAAGTGCAGTCCAGGTAGG + Exonic
900573813 1:3373218-3373240 CCCCCTGCTGCAGTGCCGGCGGG + Intronic
901653970 1:10758814-10758836 CCCCCGCCTGCAGTCCAGCCTGG + Intronic
901896074 1:12313349-12313371 GGCACCACTGCAGTCCCGCCTGG - Intronic
903883458 1:26528186-26528208 GCCCCCACTGCACTCCAGCCTGG - Intergenic
905247578 1:36625640-36625662 TCCCCTACTGCAGTCTCTGCTGG + Intergenic
906986443 1:50688090-50688112 GCACCCACTGCACTCCAGGCTGG + Intronic
907215107 1:52856410-52856432 GCCCCCACTGCACTCCAGCCTGG + Intronic
907882028 1:58559315-58559337 GCCACCACTGCACTCCAGGCTGG - Intergenic
910262361 1:85304707-85304729 GCCCCGACTCCAATCCCAGGAGG + Intergenic
912247697 1:107978076-107978098 GCCACGACTGCACTCCAGCCTGG + Intergenic
916912280 1:169363836-169363858 CCCCAGCCTGCAATCCCGGCAGG + Intronic
922915373 1:229253019-229253041 GCCCCGGCTGCTGTCCCTGCAGG + Intergenic
924607501 1:245547540-245547562 GCCACCACTGCACTCCAGGCTGG + Intronic
1069957942 10:72063014-72063036 GCCCCGACTGCGGTACGGGCTGG - Exonic
1070768218 10:79068429-79068451 GCCACGAGTGCACTCCAGGCGGG + Intergenic
1071291869 10:84194635-84194657 GCGGCGACTGCAGCCGCGGCGGG - Intronic
1073432279 10:103494255-103494277 CCCCCGGCTGCAGCCCCAGCAGG + Exonic
1075968396 10:126632358-126632380 GCCCCCACTGCAGTCCTTGAGGG + Intronic
1077155625 11:1089673-1089695 GCCCTGAGTGCAGTTCGGGCAGG - Intergenic
1078594385 11:12674322-12674344 GCCCCGCCTCCAGCCCCGGGCGG + Intergenic
1083339953 11:61952507-61952529 GCCCCCACTGCACTCCAGCCTGG - Intronic
1083604283 11:63968407-63968429 GCCCCCACTGCACTCCAGCCTGG + Intergenic
1084146159 11:67266462-67266484 GCCCCGACTGCAGTCCCGGCGGG + Exonic
1084571631 11:69963267-69963289 GGCCCCACTGCACTCCAGGCTGG + Intergenic
1089260665 11:117221840-117221862 GCACCCACTGCAGGCCAGGCTGG - Intronic
1089560368 11:119340448-119340470 GTCCCGACTCCAGTCCTGCCTGG - Intronic
1089734293 11:120539065-120539087 CCCCCAGCTGCAGTCTCGGCTGG - Intronic
1089969742 11:122683195-122683217 GCCGCCACTGCACTCCCGCCTGG + Intronic
1090199307 11:124842981-124843003 GCCAGGGCTGCAGACCCGGCTGG - Intergenic
1090636775 11:128694537-128694559 TCCCCTCCTGCAGCCCCGGCGGG - Intronic
1091511535 12:1131975-1131997 GCCCTGACACCAGTCCTGGCAGG - Intronic
1092409499 12:8242988-8243010 GCCCCCTCTTCAGTCCAGGCCGG - Intergenic
1092875059 12:12840628-12840650 GGCACCACTGCAGTCCAGGCTGG + Intergenic
1093733561 12:22593097-22593119 GCCCCCACTGCACTCCGGCCTGG - Intergenic
1094488242 12:30941770-30941792 ACCCCAGCTGCAGTCCCGCCTGG + Intronic
1094567864 12:31616474-31616496 GCCCCGACCGCGGCCCCGGAGGG + Intergenic
1095339757 12:41075566-41075588 GCCACCACTGCAGTCCAGCCTGG + Intergenic
1095480381 12:42628889-42628911 GCCCCAACTGCACTCCAGCCTGG - Intergenic
1096039328 12:48500452-48500474 GCCCGGCCAGCAGTCCCGTCCGG - Intergenic
1102244296 12:111345400-111345422 GCCCCCACTGCACTCCAGCCTGG + Intronic
1102244395 12:111346062-111346084 GCCCCCACTGCACTCCAGCCTGG + Intronic
1102340687 12:112119274-112119296 GCCGCCACTGCACTCCAGGCTGG + Intergenic
1103658388 12:122493462-122493484 GCCCCCACTGCAATCCAGCCTGG - Intronic
1104633410 12:130423546-130423568 GCCCAGACGGCAGGGCCGGCGGG + Intronic
1105250925 13:18697996-18698018 GCCCCCACGGCAGCCCCTGCAGG - Intergenic
1105519427 13:21118211-21118233 GCCTCGACTGCAGTCCAGCACGG - Intergenic
1105590935 13:21792232-21792254 GCCGCCACTGCAGTCCAGCCTGG - Intergenic
1106415989 13:29546246-29546268 GGCCCGAATGCAGTGCCGGCAGG - Intronic
1106725167 13:32476892-32476914 GGCTCGAGTGCAGCCCCGGCGGG + Intronic
1108044746 13:46373015-46373037 GGCCCCACTGCACTCCAGGCTGG - Intronic
1109634490 13:65096432-65096454 GCCGCCACTGCAGTCCAGCCTGG + Intergenic
1113672688 13:112185648-112185670 GCCCCAGCTGCAGTCCTAGCTGG + Intergenic
1121437380 14:93928536-93928558 GCCCTGATTCCAGCCCCGGCGGG + Exonic
1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG + Intergenic
1122854247 14:104552532-104552554 GACCTGACGGCAGTCCCGGTAGG + Intronic
1122901185 14:104782969-104782991 GCCCCGACAGCAGATGCGGCAGG + Intronic
1124932647 15:34137153-34137175 GCCGAGACTGCAGTCCAGCCTGG - Intergenic
1127267924 15:57376379-57376401 GGCCCGCCGGCAGCCCCGGCGGG + Intronic
1128087190 15:64894445-64894467 GCCCCGCATTCAGTCCCGTCAGG - Intronic
1129387011 15:75201868-75201890 GCGCCGTCTGCGGTCCCGGGCGG - Intronic
1129456573 15:75679204-75679226 GCCCCGGCTGCACTCCCGATCGG + Intronic
1130229564 15:82086331-82086353 CCCTCTACTGCAGTCCGGGCTGG + Intergenic
1132497548 16:270947-270969 GCCCCTGCTCCAGTCCCAGCGGG - Intronic
1132545979 16:533652-533674 GCCCTGTCTGCGGTCCTGGCTGG + Intronic
1132806720 16:1778393-1778415 GCCCGCAGTGCAGTCCCAGCAGG + Intronic
1133023401 16:2976798-2976820 GCACCAGCTGCAGCCCCGGCGGG - Exonic
1133350477 16:5097784-5097806 GCCCCCTCTTCAGTCCAGGCCGG - Exonic
1135604657 16:23813048-23813070 GCCACCACTGCACTCCAGGCTGG - Intergenic
1136495528 16:30641178-30641200 GCCACGACTGCAATCCAGCCTGG - Intergenic
1137594243 16:49713414-49713436 TCCCCCACTGCAGTCGCTGCAGG - Intronic
1137596000 16:49724407-49724429 GCCCCGAGTGCATTCCCTGTGGG + Intronic
1138091953 16:54182050-54182072 GCCCCCACTGCACTCCAGCCTGG - Intergenic
1138591041 16:58000106-58000128 GCCCTGCCTGCAGGCCCAGCTGG + Intronic
1139493923 16:67302325-67302347 TCCCATACTGCAGTCCAGGCAGG - Intronic
1140927883 16:79600338-79600360 GCCCTGCCTGCAGCCCGGGCCGG - Exonic
1141700258 16:85639087-85639109 GCTCAGACTGCAGCCCAGGCCGG - Intronic
1142699907 17:1652844-1652866 GACCCCACTGCACTCCAGGCTGG - Intronic
1143635562 17:8162328-8162350 GCCCCCCCTGCTGCCCCGGCTGG - Exonic
1146251164 17:31345462-31345484 GCCCCGACCGCGGCCCCGGAGGG - Intronic
1146848718 17:36203062-36203084 GCCCCCACTGCACTCCAGCCTGG - Intronic
1147362013 17:39936771-39936793 GCCACCACTGCACTCCAGGCTGG + Intergenic
1147661866 17:42121138-42121160 GCCCCAGCTGCAGCCCCAGCCGG - Exonic
1148151074 17:45396686-45396708 GCCCACACTGCAGTCGCTGCGGG - Exonic
1150615873 17:66771045-66771067 GCCCCCACTGCACTCCAGCCTGG - Intronic
1151506342 17:74530123-74530145 GACCCGACTCCAGTCCTGGCTGG - Intronic
1151573866 17:74941505-74941527 GCCCCGGCAGAAGTCCTGGCTGG + Exonic
1152714306 17:81891260-81891282 GCCCCGGCCCCAGCCCCGGCTGG + Intronic
1154437920 18:14360918-14360940 GCCCCCACGGCAGCCCCTGCAGG + Intergenic
1157517035 18:48318412-48318434 GCCCCTTCTGCCTTCCCGGCTGG + Intronic
1158877507 18:61747457-61747479 GCCCAGGCTGCAGTCCAGCCTGG - Intergenic
1161001668 19:1913984-1914006 TCCCCCACTGCAGGCCTGGCGGG - Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161734397 19:5982106-5982128 GGCACGACTGCACTCCAGGCTGG + Intergenic
1162181376 19:8871418-8871440 GCCCCCACTGCAGTCCAGGAGGG - Intronic
1162220195 19:9169873-9169895 GCCGCCACTGCAGTCCAGCCTGG - Intergenic
1162721725 19:12666754-12666776 GCCCCGCCCCCAGACCCGGCCGG + Intronic
1164722417 19:30442015-30442037 GCCCAGAAATCAGTCCCGGCTGG + Intronic
1164987434 19:32658716-32658738 GCCTGGACTGCAGTCCCAGAAGG + Intronic
1166688030 19:44807825-44807847 GCGCCCACTGCATTCCCGGCTGG + Intergenic
1167782926 19:51612202-51612224 GCCCAGAGTTCAGTCCTGGCTGG - Exonic
1168412240 19:56147214-56147236 TCCCCGCTTGCAGTCCCGCCAGG - Intronic
924977936 2:195125-195147 GCCCTCACTGCAGTTCCTGCAGG + Intergenic
926050993 2:9744763-9744785 GACCCCTCTGCAATCCCGGCAGG + Intergenic
926268031 2:11344222-11344244 GGCCCGGGTGGAGTCCCGGCCGG - Exonic
927194839 2:20540047-20540069 GTCCCGGCTGGAGTCCAGGCAGG + Intergenic
927716381 2:25355990-25356012 GTCCCGATGGCAGTGCCGGCTGG - Intergenic
929328223 2:40645284-40645306 GCTCAGCCTGCAGTCCCGACAGG - Intergenic
934713870 2:96532056-96532078 GCCCCGCATGCAGCCCCCGCCGG + Intergenic
946339919 2:219060425-219060447 GCCCCGACTGCACTTCTGCCTGG - Exonic
946546677 2:220751722-220751744 GGCGCCACTGCAGTCCCGCCTGG - Intergenic
948894664 2:240922532-240922554 TCCCCAGCTGCAGGCCCGGCTGG + Exonic
948910110 2:240998619-240998641 GCCCCGAACGCGGTCCCGCCCGG + Intergenic
1169135488 20:3194742-3194764 GCCCTGCCTGCAGCCCCCGCTGG + Intronic
1173516568 20:43668715-43668737 TCTCCGTCTGCAGTCCAGGCCGG + Intronic
1174802015 20:53572368-53572390 GCCCCCACTGCACTCCAGCCTGG + Intronic
1175095719 20:56540027-56540049 ACCACCACTGCAGTCCAGGCTGG + Intergenic
1175201594 20:57281617-57281639 ACCCCCACTGCAGTCCAGCCTGG + Intergenic
1176117635 20:63440008-63440030 GCCCCCACTGCATCCCCGCCAGG + Intronic
1176312304 21:5158610-5158632 GCCCCGGCTGCAGGCACTGCCGG - Intergenic
1179507608 21:41852287-41852309 GCCCAGACTGCAGCCACGCCGGG - Intronic
1179844744 21:44103420-44103442 GCCCCGGCTGCAGGCACTGCCGG + Exonic
1179996627 21:44977296-44977318 GCCCCCACGGCAGCCCCTGCAGG - Intergenic
1181034989 22:20165595-20165617 CCTCCCACTGCAATCCCGGCAGG + Intergenic
1182638886 22:31751229-31751251 GCCCCCACTGCACTCCAGCCTGG + Intergenic
1182664610 22:31948430-31948452 GCCACGACTGCACTCCAGCCTGG - Intronic
1183679506 22:39319452-39319474 GGCCAGACTGAAGTCCCCGCTGG + Intronic
1184034352 22:41911349-41911371 CCCCTGACTGCTGTCCCCGCAGG - Exonic
1185237287 22:49721537-49721559 GCCCCAACTGGACTCCCGGGTGG + Intergenic
952416814 3:33097095-33097117 GCGCCGACTGCAGAGCCGGGAGG - Exonic
953311810 3:41887778-41887800 GCCACTACTGCACTCCCGCCTGG + Intronic
956422713 3:69101364-69101386 TCCCCCACTGCACTCCTGGCTGG - Intronic
960635195 3:119778014-119778036 GCCCCCACTGCACTCCAGCCTGG + Intergenic
962071212 3:132035163-132035185 GCCCAGACTGCGGGCGCGGCAGG - Exonic
968086369 3:195875720-195875742 GCCCCTGCTTCAGTCACGGCCGG - Intronic
968708334 4:2094452-2094474 ACCCTGACTGCAGCCCCTGCAGG + Intronic
968892332 4:3376065-3376087 GCCCCTACTGCTGTCCCAGGAGG + Intronic
972418762 4:38867764-38867786 GCCACGTCTGCAGGGCCGGCGGG - Intronic
973894266 4:55396268-55396290 GCCCCGGCTGCGGTCCGGGCCGG + Exonic
976162996 4:82223353-82223375 GCCCCCTCTGCAGTCCCAGAGGG - Intergenic
981146746 4:141333305-141333327 GCTCCGAGTGCAGGGCCGGCCGG + Intergenic
981146753 4:141333330-141333352 GCTCCGAGTGCAGGGCCGGCCGG + Intergenic
981146760 4:141333355-141333377 GCTCCGAGTGCAGGGCCGGCCGG + Intergenic
981146767 4:141333380-141333402 GCTCCGAGTGCAGGGCCGGCCGG + Intergenic
981146774 4:141333405-141333427 GCTCCGAGTGCAGGGCCGGCCGG + Intergenic
981146781 4:141333430-141333452 GCTCCGAGTGCAGGGCCGGCCGG + Intergenic
981146788 4:141333455-141333477 GCTCCGAGTGCAGGGCCGGCCGG + Intergenic
983523294 4:168733775-168733797 GCACCCACTGCAGTCCGGCCAGG - Intronic
985544823 5:504365-504387 GCCCTGGCTGCAGCCCCGGGGGG - Intronic
992162076 5:74013676-74013698 TGCCCCACTGCAGTCCTGGCTGG + Intergenic
994922356 5:106063899-106063921 GCCCCCACTGCACTCCAGCCTGG + Intergenic
998272883 5:140723507-140723529 ACCCCCACTGCACTCCCGCCTGG - Intergenic
1000619285 5:163464568-163464590 GACACCACTGCAGTCCAGGCTGG + Intronic
1002426581 5:179180339-179180361 GCCTCGGCTGCTGTCCCAGCTGG - Intronic
1003175916 6:3752016-3752038 GCCCCGCCTCCCTTCCCGGCTGG - Exonic
1008570297 6:52810529-52810551 GCCCCCACTGCACTCCAGCCTGG - Intergenic
1010445581 6:75945391-75945413 GCCCCCACTGCACTCCAGCCTGG - Intronic
1011633868 6:89352700-89352722 ACCCCGCCCGCAGTCCAGGCTGG - Exonic
1017962094 6:159232247-159232269 GCCCTCACTGCAGTCCTGCCGGG - Exonic
1018754340 6:166836937-166836959 GCCCCGTCTTCAGTCCCGCTCGG + Intronic
1021204200 7:17759876-17759898 GACCCCACTGCACTCCAGGCTGG + Intergenic
1022103695 7:27184013-27184035 GCCGGGACTCCAGTCCCGGCCGG - Intronic
1023054553 7:36281056-36281078 GCGCCTAAAGCAGTCCCGGCTGG - Intronic
1025716417 7:63961491-63961513 ACCCCCACTGCACTCCAGGCTGG + Intergenic
1027132868 7:75603828-75603850 GCCCCCACTGCATTCCAGCCTGG + Intronic
1027274486 7:76544171-76544193 TCCACCACTGCATTCCCGGCTGG + Intergenic
1028194545 7:87890487-87890509 ACCCCCACTGCAGTCCAGCCTGG + Intronic
1028985428 7:97005406-97005428 CCCCCGGCTGCAGCTCCGGCTGG + Intergenic
1029529487 7:101115815-101115837 GCCCCAACTGCACTCCAGCCTGG - Intergenic
1034002487 7:147431005-147431027 GCCCCTCCTGCACTCCAGGCTGG + Intronic
1037615549 8:20515875-20515897 GCCCCGACAGAAGTCCCAGCTGG + Intergenic
1038257727 8:25966096-25966118 GACCCAACTGCAGGCCAGGCTGG + Intronic
1039716041 8:40110242-40110264 GCCGCGACTGCACTCCAGCCTGG + Intergenic
1040312041 8:46241810-46241832 GCCCCGAGGGCTGTCCCGGGCGG + Intergenic
1040341328 8:46442612-46442634 GCCCCCACAGCTGTCCCGGGTGG - Intergenic
1044607550 8:94060388-94060410 GCCCCCACTGCACTCCAGCCTGG - Intergenic
1044995990 8:97838649-97838671 GCCCCAGCTGCAGTCCCAACTGG - Intronic
1045222807 8:100214934-100214956 GCCACCACTGCAGTCCAGCCTGG + Intronic
1045368913 8:101501589-101501611 GCCCCGGCAGCAGCCCCTGCTGG - Intronic
1048790330 8:138097994-138098016 GCCCAGGCTGGAGTCCAGGCTGG + Intergenic
1049383830 8:142331040-142331062 GGCCCCACTGCAGCCCGGGCAGG + Intronic
1053001212 9:34578139-34578161 ACCCCCACAGCGGTCCCGGCGGG + Intronic
1056687423 9:88778120-88778142 GCCCAGGCTGCAGGCCCAGCTGG + Intergenic
1057290454 9:93802922-93802944 GCCCCTAATGCAATCCAGGCAGG + Intergenic
1057921931 9:99104971-99104993 GCCCCGCCTGCGGGCCCGCCAGG - Intronic
1057995592 9:99819905-99819927 GCCCCCTCCGCACTCCCGGCGGG + Intergenic
1062426915 9:136510364-136510386 GCCCGGCCTGCACTCCCGCCTGG - Intronic
1062432640 9:136532871-136532893 GCCTGGACTGCAGCCCCTGCAGG + Intronic
1062542252 9:137046651-137046673 GCCCCGACTGCAGCTTTGGCTGG + Intergenic
1185892826 X:3835716-3835738 GCCGCGGCGGCTGTCCCGGCCGG - Intronic
1185897934 X:3874136-3874158 GCCGCGGCGGCTGTCCCGGCCGG - Intergenic
1185903053 X:3912567-3912589 GCCGCGGCGGCTGTCCCGGCCGG - Intergenic
1188005593 X:25013845-25013867 GCCCCGGCAGCAGCCCTGGCTGG - Intronic
1188391393 X:29624801-29624823 GCCCCCACTGCACTCCAGCCTGG + Intronic
1194106701 X:89778485-89778507 AACCAGACTCCAGTCCCGGCAGG + Intergenic
1198149147 X:133890983-133891005 GGCACCACTGCAGTCCAGGCTGG + Intronic
1200458665 Y:3426349-3426371 AACCAGACTCCAGTCCCGGCAGG + Intergenic
1202282320 Y:23202543-23202565 GCCCCCACTGCATTCCAGCCTGG + Intergenic
1202283571 Y:23215976-23215998 GCCCCCACTGCATTCCAGCCTGG - Intergenic
1202433991 Y:24816928-24816950 GCCCCCACTGCATTCCAGCCTGG + Intergenic
1202435248 Y:24830362-24830384 GCCCCCACTGCATTCCAGCCTGG - Intergenic