ID: 1084146159

View in Genome Browser
Species Human (GRCh38)
Location 11:67266462-67266484
Sequence GCCCCGACTGCAGTCCCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084146151_1084146159 13 Left 1084146151 11:67266426-67266448 CCGGGGCGCGGGCGCGCGGGCGG 0: 1
1: 1
2: 13
3: 109
4: 612
Right 1084146159 11:67266462-67266484 GCCCCGACTGCAGTCCCGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084146159 Original CRISPR GCCCCGACTGCAGTCCCGGC GGG Exonic