ID: 1084150409

View in Genome Browser
Species Human (GRCh38)
Location 11:67285568-67285590
Sequence CCTCCCGGGGGAGCTGGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 544}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084150409_1084150419 -7 Left 1084150409 11:67285568-67285590 CCTGGCCCAGCTCCCCCGGGAGG 0: 1
1: 0
2: 3
3: 57
4: 544
Right 1084150419 11:67285584-67285606 CGGGAGGGGCCCGCTTGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 126
1084150409_1084150424 24 Left 1084150409 11:67285568-67285590 CCTGGCCCAGCTCCCCCGGGAGG 0: 1
1: 0
2: 3
3: 57
4: 544
Right 1084150424 11:67285615-67285637 GCACCAACCCAGCCGCTGCCCGG 0: 1
1: 0
2: 3
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084150409 Original CRISPR CCTCCCGGGGGAGCTGGGCC AGG (reversed) Exonic