ID: 1084154934

View in Genome Browser
Species Human (GRCh38)
Location 11:67308097-67308119
Sequence CAGAGGTCCCAGAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 7, 3: 68, 4: 554}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084154920_1084154934 24 Left 1084154920 11:67308050-67308072 CCTTGGCCTTGGCCCTAATCCAT 0: 1
1: 0
2: 2
3: 42
4: 190
Right 1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG 0: 1
1: 0
2: 7
3: 68
4: 554
1084154921_1084154934 18 Left 1084154921 11:67308056-67308078 CCTTGGCCCTAATCCATCTAGAT 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG 0: 1
1: 0
2: 7
3: 68
4: 554
1084154928_1084154934 5 Left 1084154928 11:67308069-67308091 CCATCTAGATGGGATAGGGTGCT 0: 1
1: 0
2: 1
3: 6
4: 54
Right 1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG 0: 1
1: 0
2: 7
3: 68
4: 554
1084154925_1084154934 11 Left 1084154925 11:67308063-67308085 CCTAATCCATCTAGATGGGATAG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG 0: 1
1: 0
2: 7
3: 68
4: 554
1084154924_1084154934 12 Left 1084154924 11:67308062-67308084 CCCTAATCCATCTAGATGGGATA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG 0: 1
1: 0
2: 7
3: 68
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084154934 Original CRISPR CAGAGGTCCCAGAGGGAAGG TGG Intronic
900126665 1:1071829-1071851 CAGAGGCCCGAGGGGGGAGGCGG + Exonic
900387333 1:2416619-2416641 CAGAGGCCCCAGAGCCAAGATGG + Intergenic
900482592 1:2906404-2906426 CAGAGGCCCCTGAGGGATGCTGG - Intergenic
900628833 1:3623204-3623226 CAGAGATTCCAGAGAGAGGGAGG - Intergenic
900739541 1:4322301-4322323 CAGAGAGCCAAAAGGGAAGGTGG + Intergenic
900830795 1:4963781-4963803 TAGAGGACCCAGAGGGCAGCTGG + Intergenic
900988864 1:6088792-6088814 CACAGGGCTCAGAGGGGAGGGGG - Intronic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
901989066 1:13097765-13097787 CAGCGATCCCAGAGGGAGGCGGG + Intergenic
901992747 1:13129002-13129024 CAGCGATCCCAGAGGGAGGCGGG - Intergenic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902264827 1:15255818-15255840 TAGAGGTCAGAGTGGGAAGGGGG + Intronic
902642459 1:17775464-17775486 GAGAGGTACCAGAGGCCAGGAGG + Intronic
902690229 1:18106525-18106547 GTGAGGTTCCAGAGGGCAGGAGG + Intergenic
903365089 1:22801331-22801353 CAGAGGGCCCACAGGAAGGGGGG - Intronic
904532890 1:31180914-31180936 CATAGGTCCAAGATGGAGGGGGG + Exonic
905009731 1:34739247-34739269 CAGCAGGCCCAGAGGAAAGGCGG - Intronic
905774359 1:40659043-40659065 CAGATGTGGCAGAGGGAGGGTGG + Intronic
905865337 1:41373459-41373481 CAGATGGCCCTAAGGGAAGGGGG + Intronic
906311846 1:44759978-44760000 TAAAGGGCCCAAAGGGAAGGGGG - Intronic
907097304 1:51793422-51793444 CAGAGGCTCCAGAGAGAAGCAGG + Intronic
907158351 1:52354303-52354325 CTCAGGTCCGAGAGGAAAGGGGG - Intronic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
909496345 1:76283099-76283121 CAGAGGTCACTGAGGGATGGGGG - Intronic
909784062 1:79587378-79587400 CAGAGTTTCCAAAGAGAAGGGGG - Intergenic
910124061 1:83820692-83820714 CAAAGGTCACAGAGTGAGGGAGG - Intergenic
911032168 1:93500684-93500706 TAGTGGTCCCAGAAGGAAGGGGG + Intronic
912390656 1:109300382-109300404 GAGGAGGCCCAGAGGGAAGGCGG + Intronic
912957485 1:114165683-114165705 AAGAGGCCCATGAGGGAAGGAGG + Intergenic
912974054 1:114311759-114311781 TACAGGTCCCAGAGAGAAGAGGG - Intergenic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
913168761 1:116213020-116213042 GAGAGGACACAGAGAGAAGGTGG + Intergenic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
914804457 1:150982356-150982378 CAGAGGTGCCAGAGGTGAGGTGG - Exonic
914908753 1:151768129-151768151 CAGAGGTCTGGGAGGTAAGGCGG - Exonic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
915062648 1:153198977-153198999 CAGAGGACCAAAAGGGAAGAGGG + Intergenic
915553269 1:156647187-156647209 GGGAGGTTCCAGAGGGAGGGAGG + Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
918920583 1:190704309-190704331 CAGAGAACCCAGAGGGTAAGTGG + Intergenic
920227849 1:204450934-204450956 CAGAGGGCGCAGAGGCAGGGCGG + Intronic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920260180 1:204683915-204683937 CACAGGGCCCAAAGGCAAGGGGG + Intronic
920904684 1:210151076-210151098 CAGAAGACTCAGGGGGAAGGAGG + Intronic
921098595 1:211909163-211909185 CAGAGGGCCCAGAGCAAAGGTGG + Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921508479 1:216003468-216003490 CAGAGGCCTCATTGGGAAGGTGG + Intronic
921740810 1:218682303-218682325 CAGAGATGCCACAAGGAAGGAGG + Intergenic
921766999 1:218983704-218983726 GAGGGGTCCCAGATGGAAGGGGG + Intergenic
922195106 1:223352952-223352974 CGGAGGTCCATGAGGGAGGGAGG - Intronic
923092964 1:230753588-230753610 CAGAGGTCTCTCGGGGAAGGCGG + Intronic
923175803 1:231463742-231463764 GTGAGGTCCCAGCTGGAAGGCGG + Intergenic
923737823 1:236628112-236628134 GAGAGGGCCCAGAGGAAATGGGG + Intergenic
924382268 1:243475445-243475467 AAGAGGCGCCGGAGGGAAGGGGG - Intronic
1063512120 10:6655766-6655788 ATGAGGTCCCAGGGAGAAGGTGG - Intergenic
1064620618 10:17213034-17213056 TAGAGCTCACAGAGGGAAAGAGG - Intergenic
1065245688 10:23754693-23754715 CAAGGGTCCCAAAGAGAAGGTGG - Intronic
1065312737 10:24431828-24431850 CAGAGTTCCCAGGGGGTATGTGG - Intronic
1065550255 10:26862350-26862372 CAGAGGTCGAAGAGGGAAACTGG - Intergenic
1067515584 10:46938783-46938805 CTGTGATCCCAGAGAGAAGGGGG - Intronic
1067646667 10:48113032-48113054 CTGTGATCCCAGAGAGAAGGGGG + Intergenic
1068572042 10:58640488-58640510 AAGAGGTCACAAAGGGAAGAAGG - Intronic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069614639 10:69799271-69799293 CAGGGCTCCCAGAAGAAAGGGGG - Intergenic
1069628009 10:69880296-69880318 CAGAGGGCACAGGGGCAAGGAGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070162680 10:73875055-73875077 GTCAGCTCCCAGAGGGAAGGCGG - Intergenic
1070497955 10:77041679-77041701 CAGGCCTCCCTGAGGGAAGGAGG + Intronic
1070643789 10:78187395-78187417 CTGAGGTCCAAGAGGGATGTTGG + Intergenic
1070760194 10:79019454-79019476 CAGGTGTCCAAGAGGGAAAGGGG - Intergenic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1070798344 10:79230244-79230266 CAGTGGTCCCAAGGGGAAAGGGG - Intronic
1071133595 10:82426197-82426219 CAGGGGTCTCAGAGTGAAGATGG - Intronic
1071598641 10:86945331-86945353 CAGAGGTCAAGGGGGGAAGGGGG + Intronic
1072729838 10:97838251-97838273 CAGAGGTCCCAGGGGTAACTGGG - Intergenic
1073077079 10:100830818-100830840 GAGAGGTTGCAGGGGGAAGGGGG + Intergenic
1073323505 10:102629575-102629597 CAAAGGCTCCAAAGGGAAGGAGG - Intronic
1073379032 10:103063727-103063749 AAGAATTCCCAGAGGGAAGTAGG - Intronic
1073812320 10:107164551-107164573 GAGGGGTCCCAGAACGAAGGTGG + Intergenic
1073921638 10:108466281-108466303 GAGGGGTCCCAGACCGAAGGTGG + Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074861502 10:117513671-117513693 AATAGGTCCCAGAGGGGATGGGG - Intergenic
1075520054 10:123137728-123137750 CTGAGGCCCCAGAGGGGTGGGGG + Exonic
1075647189 10:124104386-124104408 TACAGGTCCCAGAGAGAAGAGGG + Intergenic
1075709123 10:124521342-124521364 CTGAGGTGCCAGAGGGCTGGGGG - Intronic
1076222199 10:128743252-128743274 CAGAGGGGCCAGAGGCAGGGTGG + Intergenic
1076562055 10:131373473-131373495 CAGAAGTTCCACAGGGACGGGGG - Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076780882 10:132723777-132723799 CAGAGGCTCCCGAGGGAGGGCGG - Intronic
1076853560 10:133104607-133104629 AAGGGGGCCCAGAGGGCAGGGGG - Intronic
1077021869 11:420560-420582 CAGCGGCGCCAGCGGGAAGGCGG + Exonic
1077207010 11:1349571-1349593 GAGACGTCTCAGAGGGAAGCTGG - Intergenic
1077299202 11:1839413-1839435 CAGCTGTCCCCGAGGGAGGGTGG - Intronic
1077391851 11:2303944-2303966 CAGACGGCCCTGAGGGAAGGAGG - Intronic
1077552093 11:3205010-3205032 CCCAGGTCCCTGAGGGAGGGTGG + Intergenic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1077907269 11:6544291-6544313 AGGATGTCCCAGAGGGATGGGGG + Intronic
1078098326 11:8313742-8313764 GAGGGCACCCAGAGGGAAGGTGG + Intergenic
1078559730 11:12360687-12360709 AAGAGGGCCAAGAGAGAAGGTGG + Intergenic
1078742665 11:14081732-14081754 CTCAGGTCCCAAAGGAAAGGGGG + Intronic
1078791596 11:14547935-14547957 CAGAGGTCCCAGAGTAGAGGAGG + Intronic
1080453729 11:32399914-32399936 GACAGGCCCCAGCGGGAAGGGGG - Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080715050 11:34792199-34792221 CAGAGGTCCTGGAGTGAAGGAGG - Intergenic
1081174220 11:39906893-39906915 CATAGATACCAGAGGGAAGTTGG + Intergenic
1081679245 11:44990174-44990196 CAGCGATCCCATGGGGAAGGCGG + Intergenic
1083295877 11:61715464-61715486 AAGAGCTCCCAGGGGGATGGGGG - Intronic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084366592 11:68705227-68705249 CAGAGGATCCAGAGAGCAGGAGG - Intergenic
1084600061 11:70139992-70140014 CGCAGCTCCCAAAGGGAAGGAGG - Intronic
1084604709 11:70165700-70165722 AGGAGGACACAGAGGGAAGGTGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085317521 11:75554592-75554614 CAGAGGTTCCAGCAGGGAGGGGG - Intergenic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1088456372 11:110036768-110036790 AAGAGGTTCCAGAGATAAGGAGG + Intergenic
1088490113 11:110378699-110378721 CAGATTTCCCTGAGAGAAGGAGG - Intergenic
1088966374 11:114725694-114725716 CAGAGGTCCCAGAGAGATTAGGG - Intergenic
1089131375 11:116214955-116214977 CTGAGGTCCCAGAGAGGAGAGGG - Intergenic
1089326864 11:117663428-117663450 AAGAGCTCCCAGAGGGATGCTGG - Intronic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1090080423 11:123608906-123608928 CTGAGGTGGCCGAGGGAAGGAGG - Intronic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1090700138 11:129287009-129287031 CGAAGGCTCCAGAGGGAAGGAGG + Intergenic
1091278859 11:134370646-134370668 CAGAGGTCCCTGAGGAACAGCGG + Intronic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092064483 12:5578463-5578485 CACAGGTGCCAGGGGAAAGGAGG + Exonic
1092077347 12:5684807-5684829 TAGAGATCCCAGAGAGAAGCTGG + Intronic
1092154649 12:6274365-6274387 CAGATAACCCAGAGCGAAGGAGG + Intergenic
1092377346 12:7966921-7966943 GAGAGGTGGCAGAGGGCAGGGGG + Intergenic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095620430 12:44247897-44247919 AAGAGGTTCCACAGGCAAGGCGG - Intronic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1096918297 12:55057216-55057238 CAGTAGTCCCAGAGTAAAGGTGG - Intergenic
1097287922 12:57891957-57891979 CAGGGGTACCAGATGTAAGGGGG + Intergenic
1097957507 12:65501238-65501260 CAGAGGAGCCAGAGCCAAGGTGG - Intergenic
1098661619 12:73101440-73101462 GAGAGGTCCCAAAGGGAAAAGGG - Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1101752467 12:107593761-107593783 CAGAGCAACAAGAGGGAAGGTGG - Intronic
1102645655 12:114402009-114402031 CACAGGCTCCAGCGGGAAGGAGG - Intronic
1102891024 12:116558742-116558764 GAGAGGTCCCTGCGGGATGGGGG - Intergenic
1103089467 12:118087358-118087380 CAGAGGACCAAGGGGTAAGGAGG + Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103516781 12:121513440-121513462 CAGAGGGCGAAGGGGGAAGGAGG + Intronic
1103796402 12:123506173-123506195 CAGAGGCCACAGAGGAAAGGAGG + Intronic
1104478167 12:129087583-129087605 CAGAGGCCCAGGAAGGAAGGAGG + Intronic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1107333019 13:39321816-39321838 GAGTGGGCCCAGAGGGAATGAGG - Intergenic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1108444340 13:50492191-50492213 CAGATGTCCTAGAGAGATGGTGG - Intronic
1108536458 13:51385460-51385482 CGGAGATCCAAGAGGGAAAGTGG + Intronic
1108877206 13:55061209-55061231 CAGAGCTCCCATAGGAAGGGAGG - Intergenic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1110035130 13:70673165-70673187 CAGAGCTCTCAGAGGGAGGGTGG - Intergenic
1111666702 13:91278659-91278681 TACAGGTCCAAGAGAGAAGGGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112358722 13:98696933-98696955 GTGAGGACCTAGAGGGAAGGTGG + Intronic
1112437328 13:99399689-99399711 CAGAGTTCCCAGGGGGCAGTAGG - Intergenic
1112495970 13:99905052-99905074 CACAGGTCTCAGAGGGAAAGGGG + Intergenic
1112978278 13:105348424-105348446 GTGAGGTTCCAGAGGCAAGGCGG - Intergenic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1118347755 14:64951992-64952014 CAGAGGTCCCATAGGGACTAGGG - Intronic
1118615217 14:67570295-67570317 CTCAGGTCCCAGAGGGCAGTGGG + Intronic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1119198648 14:72736620-72736642 AGGAGGTCCCAGAATGAAGGAGG + Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1119951537 14:78750823-78750845 CAGAGGTCTCAGAGCTCAGGAGG + Intronic
1121089339 14:91170385-91170407 CAGTGGTCCCAGAGGTGAGTGGG - Intronic
1121466810 14:94120939-94120961 TACAGGTCCCAGAGAGAAGAGGG - Intergenic
1121508362 14:94493470-94493492 AAGCAGTCCCAGAGGGATGGGGG + Intronic
1121724663 14:96138375-96138397 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1123674413 15:22694917-22694939 CAAAGGACCCAGAGGAAACGGGG - Intergenic
1123706404 15:22954200-22954222 GAGAGGACACAGAGAGAAGGTGG + Intronic
1124244128 15:28055750-28055772 GAGATGTCCCTGAGGGGAGGTGG - Intronic
1124326425 15:28767905-28767927 CAAAGGACCCAGAGGAAACGGGG - Intergenic
1124416497 15:29476743-29476765 CAGAGGTACCAAAGTGAGGGCGG + Intronic
1126192796 15:45896280-45896302 CAGAGGTACAAGAGGGAAAGCGG - Intergenic
1127969469 15:63947081-63947103 GAGAGGTAGCAGAGGGAAAGCGG - Intronic
1128158033 15:65404029-65404051 CCAAGGTCAGAGAGGGAAGGGGG + Intronic
1128292863 15:66491768-66491790 CACAGGTCCCACAAGGAAGGTGG - Exonic
1128562222 15:68676438-68676460 CTGAGGTGCCAGAGGGTAAGGGG + Intronic
1128741160 15:70084601-70084623 CTGAGGTCCACGAGGGAAGCAGG + Intronic
1129117155 15:73370765-73370787 GAGAGGTCCCTGAGATAAGGTGG - Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129526919 15:76224213-76224235 AAGATGTTCCAGTGGGAAGGGGG - Intronic
1129734181 15:77950735-77950757 CAGTGGTCCCTTTGGGAAGGTGG - Intergenic
1129763550 15:78146698-78146720 CAGAAGTCTCAGATGGAAGTTGG - Intronic
1129841402 15:78745256-78745278 CAGTGGTCCCTTTGGGAAGGTGG + Intergenic
1130087688 15:80791808-80791830 CAGAGGCGGCAGAGGGAAAGTGG + Intronic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1130144353 15:81261955-81261977 CTGAGGTCCCAGCTGGTAGGAGG + Intronic
1131539014 15:93260640-93260662 CTGAGGTGCCAGAGGGCACGCGG + Intergenic
1132012421 15:98287770-98287792 CAGAGGGCCCCGTGGAAAGGAGG - Intergenic
1132503030 16:293103-293125 CAGAGGTCCTGGAGGCATGGCGG - Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132568075 16:632206-632228 CACTGGTCCCGGATGGAAGGAGG - Intronic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1133200619 16:4202132-4202154 CACAGCTGTCAGAGGGAAGGAGG + Intronic
1133771009 16:8867274-8867296 CAGGGGTCACAGAGGGAGTGGGG - Intronic
1133931124 16:10232873-10232895 GTGAGGTCCCAGTGAGAAGGTGG - Intergenic
1134123630 16:11601383-11601405 GGGAAATCCCAGAGGGAAGGGGG + Intronic
1134244719 16:12531441-12531463 CAGATGGCCAAGAGGAAAGGGGG + Intronic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1134690112 16:16185462-16185484 CAGCCTTCCCAGAGTGAAGGGGG + Intronic
1135044606 16:19144910-19144932 CTGAGATCCCAGTGGGAAAGAGG - Intronic
1135739278 16:24959619-24959641 CAGAGGTGGCAGAGGCAAGAAGG + Intronic
1136061082 16:27726887-27726909 GAGAGGTCCCAGAGGGAGGTGGG + Intronic
1136172445 16:28497053-28497075 CAGAAGTCCCAGAGGCAGGCGGG + Exonic
1138272015 16:55702198-55702220 CTGAGGTCCGTGAAGGAAGGGGG + Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139960521 16:70714939-70714961 CAGAGCTTCCAGTGGGACGGAGG - Intronic
1140209384 16:72958877-72958899 CAGAGGCCCCAGGGGGACTGAGG + Exonic
1141154335 16:81586706-81586728 CAGAGGAGCCCGAGGGAAAGTGG - Intronic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1143095567 17:4476741-4476763 GAGAGGCCCCTGAGGGCAGGTGG - Intronic
1143109137 17:4543789-4543811 CAGAGGGCCCAGGAGGGAGGCGG - Intronic
1143133626 17:4697145-4697167 CAGAGGTCACAGAGGTGAGGAGG + Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144574288 17:16419191-16419213 CAGAAGCCCCAGAGGCAAGTTGG + Intronic
1144701809 17:17345294-17345316 CAGAGCTCCTGCAGGGAAGGTGG + Intronic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145866025 17:28242177-28242199 CTGAGGTCACAGAGTGAACGAGG - Intergenic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147178908 17:38673084-38673106 CAACGGTCCGAGATGGAAGGAGG + Exonic
1147190193 17:38733934-38733956 CAGATGTCCCAGGGCAAAGGAGG + Exonic
1147224692 17:38967544-38967566 CAGAAGCCCTAGCGGGAAGGAGG + Intergenic
1147325102 17:39666266-39666288 CTGAGTTCCCAAAGGGAGGGTGG + Exonic
1147607787 17:41784268-41784290 CAGAGGCTCCAGAGGGAATGGGG + Intronic
1147744834 17:42688714-42688736 CTGAGGCCCCAGAGGGGAAGAGG - Intronic
1147840977 17:43371238-43371260 GAGAGTTACCAGAGGTAAGGAGG + Intergenic
1148049328 17:44761383-44761405 CAGAGGTGGCAAAGGGTAGGAGG + Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1150833003 17:68540689-68540711 CGGAGGTCCCAGAGGACAGAAGG - Intronic
1151380786 17:73724422-73724444 CAAAGATCCCTGAGGGAAAGGGG + Intergenic
1151480481 17:74367681-74367703 CACAGGTCACAGGGGGAAGCTGG + Exonic
1151576212 17:74953745-74953767 TGGAGGTTCCAGAGGGAAGCAGG - Intronic
1151598241 17:75090861-75090883 GAAAGGTTCCGGAGGGAAGGTGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151886014 17:76923803-76923825 CTGAGGACCCAGTGGGGAGGGGG + Intronic
1152103663 17:78316726-78316748 CAGGGGTCCCAGAGGGTGGTGGG - Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153160665 18:2201146-2201168 TAGAATTCCCAGAGGGAATGTGG + Intergenic
1153340345 18:3966950-3966972 CTGAGGTCCAAGAGAGGAGGAGG + Intronic
1154345564 18:13540973-13540995 CAGCGGTCCCTGAGTGGAGGTGG + Intronic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155630380 18:27886310-27886332 CAGTGGTCCCCAAGGGAATGAGG - Intergenic
1155840586 18:30637616-30637638 GAGAGGACCCAGAGAGCAGGTGG + Intergenic
1156486211 18:37467315-37467337 CAGAGATCCCAGAGGGCAAGAGG + Intronic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1157491106 18:48124498-48124520 CAGAGGAGCCAGCTGGAAGGGGG + Intronic
1160245885 18:77159060-77159082 CAGAGCCTTCAGAGGGAAGGCGG + Intergenic
1160588306 18:79925255-79925277 CAGAAATCCAAGAGGGCAGGTGG + Intronic
1160904445 19:1445888-1445910 GAGAGGTCCCACGGGGAATGGGG - Intergenic
1161037041 19:2090602-2090624 CATAAGTCCCACAGGGAAGGAGG - Intronic
1161310260 19:3589970-3589992 CAGGGGTCCCAGCGGGAAGTTGG + Intronic
1162584005 19:11547930-11547952 CAGAGGTCATAGAGGCCAGGAGG + Intronic
1163558971 19:18007983-18008005 CCGGGGTCCGCGAGGGAAGGGGG + Intronic
1163716532 19:18875869-18875891 CAGAAGCCCAAGAGGCAAGGAGG + Intronic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1163859411 19:19733421-19733443 CAAAAGACCCTGAGGGAAGGAGG - Intergenic
1164637078 19:29799432-29799454 CAGAGGGGCCACAGGTAAGGAGG + Intergenic
1164752293 19:30665857-30665879 CAGAGGACTGAGAGGAAAGGAGG + Intronic
1165010248 19:32840766-32840788 CAGAGGACCCCCAGGGGAGGTGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165176511 19:33934377-33934399 CAGAGGTGGCCAAGGGAAGGTGG + Intergenic
1165829175 19:38722050-38722072 CATAGGTCCCTGAGGGAACCAGG + Intronic
1165991691 19:39818827-39818849 CACAGGGCCCAGTGGAAAGGAGG + Intergenic
1167180741 19:47901535-47901557 CAGAGCCTCCAGAGGGAATGTGG + Intergenic
1167194764 19:48020687-48020709 CAGAGGGCCCTGGAGGAAGGAGG - Intronic
1167306165 19:48710987-48711009 CATGGGTCACAGAGGGAGGGAGG - Intergenic
1167437419 19:49487468-49487490 CAGAGATTCCCCAGGGAAGGCGG - Intergenic
1168166531 19:54552133-54552155 CACAGGGCCCAGGGGGAAGTTGG - Intergenic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
925045122 2:767037-767059 CAGAGGATCCAGTGGGCAGGAGG + Intergenic
925323288 2:2993753-2993775 CAGAGGTCCCAGTAGGTAGGTGG + Intergenic
925425639 2:3746973-3746995 GAGAGGGCCCTGAGGGAAGCAGG + Intronic
925460031 2:4054042-4054064 GAGAGGATCCAGAGGCAAGGCGG - Intergenic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
925804383 2:7633788-7633810 CAGATGTCCCAGAGAAAATGGGG + Intergenic
925933607 2:8731837-8731859 CAGATGTCCCAGTTAGAAGGGGG - Exonic
926049858 2:9737720-9737742 CAGGGGTACTAGAGGGAATGGGG - Intergenic
926259274 2:11242397-11242419 CAGAGCTCAGAAAGGGAAGGAGG + Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926922128 2:17949502-17949524 GAGAGGACTCAGAGAGAAGGTGG + Intronic
927145494 2:20162784-20162806 CAGAGGTGTCAGTGGGAAGCAGG + Intergenic
927654335 2:24932782-24932804 CAGAGGTGGCAGATGGAAGGAGG + Intergenic
927843981 2:26461997-26462019 GAGAGGAGGCAGAGGGAAGGTGG - Intronic
928659795 2:33490609-33490631 TAGAGGTCAGAGAGGGGAGGAGG - Intronic
929020739 2:37550187-37550209 ATGAGGTCCTAGAGGGATGGTGG - Intergenic
929923241 2:46188558-46188580 AAGGAGTCCCAGAGTGAAGGAGG - Intergenic
930552464 2:52852673-52852695 CAGAGTTCCCGGAGGGGAGGGGG - Intergenic
930697519 2:54427049-54427071 CAGAGTTCCAAGAGAGAAAGTGG + Intergenic
930753116 2:54950995-54951017 CATAGGCCCTAGAGAGAAGGCGG + Intronic
931231165 2:60376051-60376073 CAGAGCTCCCCAAGGGAAGAAGG - Intergenic
932174351 2:69585969-69585991 GGGTGGTGCCAGAGGGAAGGTGG - Intronic
933178577 2:79204170-79204192 CAGAGGTCCCAGAGGGGAAGTGG + Intronic
933934287 2:87188501-87188523 CAGAGATCCCAGGGGGTAGAGGG - Intergenic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934517037 2:94994720-94994742 CAGAGGCCCCTGAGGGTGGGGGG - Intergenic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934655609 2:96115516-96115538 CAGAGGTCCCAGGGCCAAGGGGG - Exonic
934713064 2:96528023-96528045 CAGAGGTCCCCCAGGGACCGTGG - Intergenic
935122747 2:100196969-100196991 CGAAGGCCCCAGCGGGAAGGGGG - Intergenic
936358855 2:111777394-111777416 CAGAGATCCCAGGGGGTAGAGGG + Intronic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
937225982 2:120368995-120369017 GAGAGGTCCTGGATGGAAGGAGG + Intergenic
937257961 2:120568197-120568219 CAGAGAAGCCAGAGGGGAGGTGG - Intergenic
937739971 2:125339783-125339805 CAGAGATCCCTGAGGGGAAGAGG - Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
939513396 2:143135673-143135695 GAGAGTTTCAAGAGGGAAGGAGG - Intronic
940275757 2:151938939-151938961 CAGAGGTCCCAGAGCCAACACGG - Intronic
940378578 2:152987001-152987023 CAGAGCTCCCAGAGCCAAGAAGG - Intergenic
941132988 2:161677208-161677230 CAGAGGTCACATAGTGAGGGAGG - Intronic
944348074 2:198692687-198692709 CAGAGGACCCCCAGGGATGGTGG + Intergenic
944680820 2:202075091-202075113 CAGAGGTCCCTGGAGGAAGCTGG + Exonic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945515043 2:210752919-210752941 CAGAGGACCCACAGGAAAGGAGG - Intergenic
946250111 2:218406481-218406503 CAGAGGCCGCAGAGGGGCGGGGG - Intergenic
946355705 2:219182974-219182996 CACAGGTCCCTGAGGATAGGAGG - Exonic
947556590 2:231098868-231098890 AAGAGGTACCACAAGGAAGGGGG - Intronic
947636360 2:231682518-231682540 CAGAGGACCCAGAAGAGAGGTGG - Intergenic
947724047 2:232386616-232386638 CAGGGGTCCCTGAGGGCGGGAGG - Intergenic
947909562 2:233792179-233792201 CAGAGGAGCCCCAGGGAAGGAGG - Intronic
948465325 2:238149288-238149310 CAGAGGGCCCACAGTGAAGGGGG + Intronic
948465338 2:238149332-238149354 CAGAGGGCCCACAGTGAAGAGGG + Intronic
948465353 2:238149376-238149398 CAGAGGGCCCACAATGAAGGGGG + Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948732844 2:239978063-239978085 CAGGGATCCCAGAGGCAGGGAGG - Intronic
948732858 2:239978120-239978142 CAGGGATCCCAGAGGCAGGGGGG - Intronic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
949069167 2:242013170-242013192 CAGAGGCTCCACAGAGAAGGGGG + Intergenic
1168854294 20:997991-998013 CTGCAGTCCAAGAGGGAAGGGGG - Intronic
1170508549 20:17054199-17054221 CAGAGCTCCCAGAGGGGTGGGGG - Intergenic
1170590361 20:17766872-17766894 GAGAGTTCCCAGTGGGAAGCTGG + Intergenic
1170747711 20:19115512-19115534 CAGAGGTCCCAGAAGGGGGGAGG + Intergenic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172543791 20:35743080-35743102 GCCAGGTCCCAGGGGGAAGGGGG - Intergenic
1173027723 20:39325039-39325061 CAGAGGTCTCAGAGGAAGGAAGG + Intergenic
1173120824 20:40287408-40287430 GAGAGGTGCCAGGGGGAAGGAGG - Intergenic
1173580582 20:44143969-44143991 CAGAGGCTCGAGAGGCAAGGAGG + Intronic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1173861193 20:46284785-46284807 AAGGAGTCCCAGTGGGAAGGAGG + Intronic
1173905898 20:46628496-46628518 GACAGGTGCCACAGGGAAGGAGG + Intronic
1174952189 20:55054370-55054392 CACAGGTCCCAGAGATTAGGAGG + Intergenic
1175183999 20:57167522-57167544 CAGAGGGCCAAAAGGGAAAGTGG + Intergenic
1175692224 20:61073780-61073802 CAGAGGTGACAGAGAGATGGTGG - Intergenic
1175772054 20:61630142-61630164 CTGAGGTCCAAGAGGGACTGGGG - Intronic
1175905836 20:62378905-62378927 CACATTTCCCAGAGGGCAGGAGG + Intergenic
1176097906 20:63352768-63352790 CAGAGGACCCTGGGGGAGGGGGG - Intronic
1176141923 20:63548620-63548642 CTCAGGACCCAGAGGGGAGGTGG - Intronic
1176676579 21:9784289-9784311 CAGAGATCCCTGGGGGAGGGGGG - Intergenic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179994090 21:44966030-44966052 CTGAGGACCCAGAGGAAGGGTGG + Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181434517 22:22902599-22902621 CGAAGGTCCCAGTGGGCAGGAGG - Intergenic
1181467038 22:23115910-23115932 CACAGGGCCCAGGGGGTAGGGGG - Intronic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1181666838 22:24404427-24404449 CAGAGCTCCCTGGAGGAAGGTGG - Intronic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182285344 22:29243739-29243761 GAAAGGCCACAGAGGGAAGGTGG - Intronic
1182445609 22:30387566-30387588 CCGGGGTCGCAGCGGGAAGGCGG + Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1182885791 22:33773015-33773037 CACAGGTCCCTGAGGCAATGGGG + Intronic
1183087692 22:35496822-35496844 CAGGTGTCCCAGAGGAAAGCTGG + Intergenic
1183543791 22:38444782-38444804 CTGAGGAGCCAGTGGGAAGGTGG - Intronic
1183617267 22:38953419-38953441 CAGATGCCCCATAGAGAAGGTGG - Intronic
1183736162 22:39646036-39646058 CAGATGTCCCAGGCGGATGGGGG + Intronic
1183922106 22:41177630-41177652 CAGAGGTCCCAGTGGGCATTTGG + Exonic
1183952148 22:41357940-41357962 CTGAGGCCCCAGAGGGTAAGTGG - Exonic
1184001805 22:41680180-41680202 CAGAGGCCCCAGATGGAAACAGG + Intronic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184242574 22:43218939-43218961 CAGAGGTCAGAGAGAGGAGGAGG - Intronic
1184316689 22:43698724-43698746 CTGAGTTCCCTGAGGAAAGGTGG + Intronic
1184461243 22:44639451-44639473 CAGAGATGCCACATGGAAGGAGG + Intergenic
1185180303 22:49356279-49356301 CTGAGGTCTCAGATGGAAAGGGG - Intergenic
1185270909 22:49929040-49929062 CAGAGGTCCCGGCTGGAAGATGG - Intergenic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
950128930 3:10528410-10528432 CATGGGGCCCAGAGGCAAGGTGG - Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950450884 3:13064853-13064875 CAGAGCTGCCAGAGGGCATGTGG - Intronic
953092863 3:39746968-39746990 CAGAGGTCCCTGCGGGGGGGAGG + Intergenic
953678974 3:45025636-45025658 CAGAGGTACCAGAGAGGATGTGG - Intronic
954097756 3:48343539-48343561 GCCAGGGCCCAGAGGGAAGGTGG + Intergenic
954360872 3:50122215-50122237 CAGGGCTCCCAGATGGAAGCAGG + Intergenic
954881235 3:53837378-53837400 AAGAGGATCCAGAGGGCAGGTGG - Intronic
954910019 3:54096720-54096742 GAGAGGCTCCAAAGGGAAGGCGG + Intergenic
954980425 3:54740706-54740728 CAGAAGTCCCAGAAGGCAGTAGG + Intronic
955116601 3:56011382-56011404 CAGAGCTCCGAGATGCAAGGTGG + Intronic
955769794 3:62375402-62375424 GAGAGGTCCCTGAGGGAAAGTGG + Intergenic
958807867 3:98833820-98833842 CAGAGCTCCCACTGGGAGGGTGG - Intronic
958844278 3:99246752-99246774 CAGAGGTCCCAGCAGGAACCTGG + Intergenic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
961111989 3:124292217-124292239 GAGAGGTCCTAGAGAGTAGGAGG - Intronic
961381628 3:126499480-126499502 CACAGGGCCCAGAGGGAGGCTGG + Intronic
961467146 3:127088923-127088945 CAGAGGCCCCAGGGGCCAGGCGG - Intergenic
962367768 3:134797167-134797189 CAGCAGTCCCTGAGGGAAGCAGG - Intronic
962389910 3:134962704-134962726 TAGAGGCCCCAGAGGTAAGCTGG - Intronic
962712275 3:138097923-138097945 CAGGGGTCCCAAGGGGATGGGGG - Intronic
964474044 3:157082945-157082967 CAGAGATCCCAGAGTCAAGGAGG - Intergenic
966921292 3:184613296-184613318 CAGAGGTTCTGGAGGGAATGAGG - Intronic
967248398 3:187512522-187512544 CAGAGGGCAGAGAGGGAAAGAGG + Intergenic
968410501 4:386235-386257 CACAGGTCACAGAGCGACGGAGG - Intergenic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
968843749 4:3027945-3027967 CAGAGATCCCAGAAGGACAGAGG + Exonic
968920396 4:3519330-3519352 CAGAGGTCCCCCTAGGAAGGTGG - Intronic
969145862 4:5123609-5123631 TGGAGGACACAGAGGGAAGGTGG - Intronic
969272088 4:6109993-6110015 CACACGTCCCAGAGGCAGGGAGG + Intronic
969893051 4:10277441-10277463 CAGAGGATCCAGTGGGGAGGTGG - Intergenic
970318142 4:14848986-14849008 CAAAGGTCACAGATAGAAGGAGG - Intergenic
974314981 4:60267891-60267913 CTGAAGTCTCATAGGGAAGGTGG + Intergenic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
976874603 4:89837491-89837513 GGGAGGACCCAGAGGAAAGGCGG - Intronic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
979550085 4:121980908-121980930 CAGGGGTCCAAGAGAGAAAGTGG + Intergenic
979733460 4:124053116-124053138 CAGAGCTTCCAGAGGGAATGTGG - Intergenic
980140468 4:128909997-128910019 CAGAGAAACCAGAGTGAAGGCGG + Intronic
982642474 4:157980403-157980425 CAGAGGTCTCAGTGAGAATGAGG - Intergenic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983838378 4:172422487-172422509 CAGAGGTGGCAGAGTGTAGGAGG - Intronic
984957208 4:185057389-185057411 CAGAGCTTCTAGAGGAAAGGAGG - Intergenic
985128961 4:186723366-186723388 GCGAGCTCCCGGAGGGAAGGCGG + Intronic
985655287 5:1128556-1128578 CAGAGGTCTCAGAGTGTTGGGGG - Intergenic
986161869 5:5237478-5237500 CAGAACGCCCAGAGGGAAAGTGG + Intronic
988551409 5:32204101-32204123 TACAGATCCCAGAGGGAAGCGGG - Intergenic
988935915 5:36082946-36082968 CAGAGCTCCCAGAGGGACAGTGG + Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991202683 5:64012655-64012677 TCGAGTTCCCAAAGGGAAGGTGG + Intergenic
991659609 5:68936917-68936939 CAGAAGACCCAGAGGAAAGCAGG + Intergenic
992367655 5:76109768-76109790 TACAGGTGCCAGAGGGAACGTGG + Intronic
992427173 5:76670062-76670084 GATAGGTCCCAGAGAGATGGCGG + Intronic
992558729 5:77929309-77929331 AAGAGATGCCAGAGAGAAGGGGG + Intergenic
992820585 5:80492011-80492033 CACAGGTCGCACAGGGAAGGAGG + Intronic
993256268 5:85593962-85593984 CAAAGGTCCAAGAAGGGAGGGGG - Intergenic
995359556 5:111279472-111279494 CAGATGTGCCAGAGGGAGTGGGG + Intronic
995829147 5:116334455-116334477 CAGTGGGCCCACAGGGATGGGGG - Intronic
995856778 5:116600871-116600893 CTGGGGTCCCAGAGGAAAGCTGG + Intergenic
995911106 5:117187894-117187916 CTTAGGTCCCAGAGAAAAGGAGG + Intergenic
996760656 5:126983188-126983210 CACAGGTCCCAGAAGGGAGTTGG + Intronic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
998091527 5:139373679-139373701 GAGAGGGCACTGAGGGAAGGTGG + Intronic
998401902 5:141852705-141852727 CAGGGGTCCCATGGGGGAGGGGG - Intergenic
998461341 5:142312530-142312552 CAGAGGTGCCTCCGGGAAGGAGG - Exonic
999367287 5:151031394-151031416 CAGAAGTCCCACAGGCGAGGTGG + Intronic
999959119 5:156735375-156735397 CAGAGCTCCCAGAGGCAGTGGGG - Intronic
999966563 5:156816517-156816539 AAGAGGTGACAGAAGGAAGGGGG + Intergenic
1000286508 5:159831115-159831137 CAGAGGTTCCTGAGGGAGTGTGG + Intergenic
1001147833 5:169200220-169200242 CACAGCTCCCTGAGGAAAGGAGG - Intronic
1001219059 5:169883627-169883649 CCCAGGTCCCAGAAGGCAGGGGG - Exonic
1001273681 5:170334590-170334612 CAGAGGACCCACTGGGAAAGTGG - Intergenic
1001513024 5:172336979-172337001 CAGCGGTCCCATAGGGAGGCAGG - Exonic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1001786183 5:174415729-174415751 CAGAGGTCCCAGCGGGAGACAGG - Intergenic
1002359749 5:178661255-178661277 CAGAGGACACAAAGGGAATGAGG - Intergenic
1002593548 5:180307101-180307123 CTGAGGAGCCAGCGGGAAGGAGG - Intronic
1002601640 5:180357064-180357086 CAGAGGGCCCAGGGGGCTGGGGG + Intergenic
1002779341 6:354300-354322 CCAAGGTCCCAGAGAGCAGGCGG - Intergenic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1004496372 6:16167017-16167039 CACAAGTGCCAGGGGGAAGGAGG + Intergenic
1006390432 6:33755079-33755101 CAGGGGTCCCAGAGGGTCGTGGG + Intergenic
1006515204 6:34541788-34541810 CACAGGCCCCAGAGGCCAGGAGG + Intronic
1006803919 6:36776566-36776588 GGGTGGTCCCAGAGGGATGGGGG + Intronic
1007103417 6:39267268-39267290 GTGATGGCCCAGAGGGAAGGTGG - Intergenic
1007630221 6:43269411-43269433 GAGAAGTTCCAGAGAGAAGGAGG + Intronic
1008693838 6:54010856-54010878 AAGTGGTCCCAGTGGGAATGAGG + Intronic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1012940465 6:105409730-105409752 CAGAGTTGCAAGAGTGAAGGAGG - Intergenic
1013732475 6:113184904-113184926 CAGAGGGCCAAGACAGAAGGTGG + Intergenic
1013911655 6:115282680-115282702 CTGAGGCCCCAGAGGGAGGGTGG - Intergenic
1014943812 6:127474508-127474530 CAGAGGCCAAAGAGGGCAGGAGG - Intronic
1016416622 6:143840888-143840910 CAGAGTTCCAAGTGGTAAGGAGG + Intronic
1016764033 6:147772638-147772660 GTGAGGACCCAGAGAGAAGGTGG - Intergenic
1017492987 6:154960269-154960291 CAGAGGTCTCAGAAGAAGGGAGG - Intronic
1017493322 6:154962891-154962913 CAGAGGGCACATGGGGAAGGTGG + Intronic
1017916582 6:158836194-158836216 AAGAGGTCCCTCAGGGCAGGAGG + Intergenic
1017955737 6:159176354-159176376 CAGAGGACACACAGGCAAGGAGG + Intronic
1018267348 6:162039524-162039546 CAGAGGTCCCATGGGGAAAGGGG - Intronic
1018528425 6:164737665-164737687 TAGAGGTCCCAGAGTCAAGCAGG + Intergenic
1018583737 6:165333312-165333334 CAGAGGTGCCAGAGGGTCAGGGG + Intronic
1018680870 6:166263684-166263706 CAGAGGTCTCTGAGATAAGGAGG - Intergenic
1018967744 6:168501717-168501739 CGGAGATCCCAGAGGAAAGCAGG - Intronic
1019152413 6:170017551-170017573 GAGAGGCCCCTGAGGGAAGTTGG + Intergenic
1019162414 6:170077698-170077720 CAGAGGACACAGCGAGAAGGCGG - Intergenic
1019217026 6:170450516-170450538 CAGAGCTCCCAGTGTGAAGCTGG - Intergenic
1019429737 7:993165-993187 CTGAGGTCCCAGTGGGCGGGGGG + Intergenic
1019447439 7:1078745-1078767 CCGGGGTCCCAGTGGGCAGGTGG - Intronic
1019659652 7:2217020-2217042 GAGAGCTCCCCGAGGGCAGGTGG - Intronic
1019676177 7:2314102-2314124 CAGGGGACCCCGAGGGACGGAGG + Intronic
1021103324 7:16608560-16608582 CAGATTTGCCAGAGGGAGGGAGG + Intronic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022251209 7:28610254-28610276 GGGAGGGGCCAGAGGGAAGGCGG + Intronic
1022517484 7:30985113-30985135 CAGAGACCCCAGAGGGCGGGTGG - Intronic
1023595980 7:41829866-41829888 CACAGGTCCCAGAAGGAGGCTGG - Intergenic
1023817348 7:43961338-43961360 CAGAGGTCCCAGTGGGTAGGGGG + Intergenic
1023839628 7:44089058-44089080 GAGCAGGCCCAGAGGGAAGGAGG - Intergenic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1023977146 7:45039076-45039098 CAGAGGACCCAGAGTCCAGGGGG + Intronic
1024047085 7:45592309-45592331 GTGAGGGCACAGAGGGAAGGCGG - Intronic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1024216948 7:47255957-47255979 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1024263641 7:47590116-47590138 GAGAGATGACAGAGGGAAGGGGG - Intergenic
1024268758 7:47626412-47626434 CAGAGGTGCAAAAGGGAGGGTGG + Intergenic
1026534416 7:71228293-71228315 CACAGGTCCCAGATGGAACCAGG - Intronic
1026857183 7:73762563-73762585 AAGGGCTCCAAGAGGGAAGGGGG - Intergenic
1027960446 7:84939712-84939734 CAGTGGTCCCAGAGGGGGTGAGG + Intergenic
1029225267 7:99022410-99022432 CAGAGGTGAAACAGGGAAGGTGG + Intergenic
1029514691 7:101017867-101017889 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514712 7:101017908-101017930 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514733 7:101017949-101017971 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514754 7:101017990-101018012 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514775 7:101018031-101018053 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514796 7:101018072-101018094 GAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514817 7:101018112-101018134 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514861 7:101018196-101018218 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029741974 7:102496212-102496234 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1029759963 7:102595377-102595399 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031143579 7:117972970-117972992 CACAGGGCCCAGAGGCGAGGGGG - Intergenic
1032077357 7:128842408-128842430 CAGGGGTCCCTGAGGGAGGGCGG + Intronic
1032586840 7:133154650-133154672 CAGAGGGCCCTGTGTGAAGGAGG + Intergenic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1032803481 7:135334979-135335001 CAAAGATCTCAGAGGGAAGTAGG + Intergenic
1034167791 7:149039055-149039077 CAGAGGTGCGAGCGGGAACGGGG - Intergenic
1034490100 7:151388585-151388607 CAGGGGTCCCAGAAGCCAGGTGG - Intronic
1034589371 7:152127037-152127059 CAGGGGTCCCTGGGGGAGGGAGG + Intergenic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1034896947 7:154882210-154882232 CCGAGGTGCCAAAGGGAAAGGGG + Intronic
1035587191 8:785632-785654 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587204 8:785666-785688 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587216 8:785700-785722 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587229 8:785734-785756 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587242 8:785768-785790 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587255 8:785802-785824 CAGAGGAGCCTGAGGGGAGGAGG - Intergenic
1035587266 8:785836-785858 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1036236194 8:7041735-7041757 CAGAGGTCTCACAAGGGAGGGGG + Intergenic
1037880714 8:22572152-22572174 CTTAGGGCCCAGAGGGCAGGAGG + Intronic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038425801 8:27463101-27463123 CTGAGGCCCCAGAGTGCAGGTGG + Exonic
1038466790 8:27772151-27772173 CAAAGGCCGCAGATGGAAGGTGG + Intronic
1038922504 8:32100123-32100145 GAGAGGAGGCAGAGGGAAGGAGG - Intronic
1039583184 8:38683464-38683486 GAGGGGTCCCAGAGGGACAGGGG - Intergenic
1041206868 8:55508659-55508681 AAGAGGTTCAAGAGAGAAGGAGG + Intronic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1043591352 8:81836887-81836909 CACAGATCACATAGGGAAGGAGG - Intronic
1043727454 8:83629110-83629132 TAGAGCTCCCAGAGGGAGGGAGG - Intergenic
1045238736 8:100379171-100379193 CAAAGGGCACAGAGTGAAGGAGG - Intronic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1045902613 8:107302238-107302260 CACAGGCCCCAGAGGAAATGGGG + Intronic
1046086703 8:109445515-109445537 CAGTGGTCCCAGCGGGAGTGCGG - Exonic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047766700 8:127996048-127996070 CAGAGGTCCTTGAGGGAGGGAGG - Intergenic
1047940722 8:129825448-129825470 CAGAGGACACAGTGAGAAGGTGG - Intergenic
1049129673 8:140827258-140827280 CAGAGGTCAGACAGGAAAGGGGG - Intronic
1049172029 8:141167381-141167403 CAGAGGACCAAGAGAGCAGGAGG - Intronic
1049346832 8:142143697-142143719 CAGAGGAGCCAGTGGGAAGGGGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049397003 8:142405497-142405519 TCCAGGTCCCAGAGGGAATGTGG + Intergenic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049570892 8:143369817-143369839 CTGACGTCCCAGAGGGGAGGAGG - Intronic
1049622192 8:143603547-143603569 CAGAGGTCCCAGGGGGAGACAGG + Intergenic
1049685664 8:143938320-143938342 TGCTGGTCCCAGAGGGAAGGAGG + Intronic
1049702418 8:144021220-144021242 GAGAGGGTCCTGAGGGAAGGCGG - Intronic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049702496 8:144021510-144021532 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049702703 8:144022357-144022379 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049703056 8:144023715-144023737 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703150 8:144024051-144024073 AAGAGGGTCCTGAGGGAAGGTGG - Intronic
1049703290 8:144024525-144024547 GAGAGGGTCCTGAGGGAAGGGGG - Intronic
1049703345 8:144024748-144024770 GAGAGGGTCCTGAGGGAAGGAGG - Intronic
1051693502 9:19742957-19742979 TAGAGATCCCAGAGGGAAATGGG + Intronic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1053034845 9:34816157-34816179 CAGAAGTTCCAGTGGGAAGATGG - Intergenic
1053127254 9:35592295-35592317 GGGAGGTCCCAAAGGGAATGTGG - Intergenic
1053667163 9:40324493-40324515 CAGAGGTCCCCGGGGGGGGGGGG - Intronic
1054378309 9:64464521-64464543 CAGAGGTCCCCGGGGGGGGGTGG - Intergenic
1054517447 9:66051790-66051812 CAGAGGTCCCCGGGGGGGGGGGG + Intergenic
1055120323 9:72652535-72652557 GACAGTTACCAGAGGGAAGGTGG + Intronic
1055690451 9:78824437-78824459 CTGAGGACGCAGTGGGAAGGTGG - Intergenic
1055722060 9:79186195-79186217 CAGAGCTTCCAGAAGGAATGTGG - Intergenic
1055913070 9:81373496-81373518 AAGAGGTCCCTGGGGAAAGGCGG + Intergenic
1056132923 9:83603110-83603132 GAGAGGACCCAGAGAGAGGGAGG - Intergenic
1056272004 9:84955551-84955573 CAGGGGTCCCGCAGGGAAAGAGG - Intronic
1056665296 9:88576785-88576807 CAGAGAACCCAGAGGAAAGCAGG - Intronic
1059529573 9:115023498-115023520 CTGAGGTCACAGAGTGAAGTTGG - Intronic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1061281051 9:129597742-129597764 CTGAGGTCCCACAGCGCAGGCGG - Intergenic
1061872679 9:133529089-133529111 CAGAGGTCCCAGAGCTAGGATGG - Intergenic
1062343012 9:136102126-136102148 CAGCTGGCCCAGAGGGAAAGTGG + Intergenic
1062475542 9:136725019-136725041 CAGTGGTCCCAGAGGGGGTGAGG + Intergenic
1062573411 9:137195699-137195721 CAGAGAGCCAAGAGGGGAGGAGG + Intronic
1062625038 9:137438741-137438763 CAGAGGGCCCTGTGGGAGGGGGG + Intronic
1062694695 9:137867440-137867462 CAGAGGTTCCAGAGGACTGGAGG + Intronic
1186485115 X:9928237-9928259 CACAGTTCCCAGAGGGGAGAGGG - Intronic
1188246470 X:27841098-27841120 CTGAGGTGTCAGAGGCAAGGTGG - Intergenic
1189316862 X:40062710-40062732 CACAGGCCCCAGAGGGAAGCCGG + Intronic
1190960369 X:55240919-55240941 CTGAGTTCCCAGTGGGGAGGGGG + Intronic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1194856817 X:98940646-98940668 TACAGATCCCAGAGGGAAGAAGG - Intergenic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1197203944 X:123773709-123773731 CATAGATCCCAGAGAGAAGAAGG + Intergenic
1199316349 X:146382737-146382759 TAGAAGTCCCAGAGGGAGGGAGG + Intergenic
1199926350 X:152469287-152469309 CAGAGGCTACAGAGTGAAGGGGG + Intergenic
1200336290 X:155354247-155354269 CAGAGCTCCCGGAGGGAGGGAGG + Intergenic
1200350180 X:155486980-155487002 CAGAGCTCCCGGAGGGAGGGAGG - Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic