ID: 1084155498

View in Genome Browser
Species Human (GRCh38)
Location 11:67310646-67310668
Sequence CTGTAGGCACAGGCTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 396}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084155493_1084155498 -1 Left 1084155493 11:67310624-67310646 CCAGTGAGGGCAGGCGGAGGCAC 0: 1
1: 0
2: 3
3: 18
4: 231
Right 1084155498 11:67310646-67310668 CTGTAGGCACAGGCTGGAGAGGG 0: 1
1: 0
2: 2
3: 28
4: 396
1084155487_1084155498 17 Left 1084155487 11:67310606-67310628 CCTGAGAGCAGCTGAGATCCAGT 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1084155498 11:67310646-67310668 CTGTAGGCACAGGCTGGAGAGGG 0: 1
1: 0
2: 2
3: 28
4: 396
1084155486_1084155498 18 Left 1084155486 11:67310605-67310627 CCCTGAGAGCAGCTGAGATCCAG 0: 1
1: 0
2: 0
3: 24
4: 300
Right 1084155498 11:67310646-67310668 CTGTAGGCACAGGCTGGAGAGGG 0: 1
1: 0
2: 2
3: 28
4: 396
1084155484_1084155498 25 Left 1084155484 11:67310598-67310620 CCTGGGCCCCTGAGAGCAGCTGA 0: 1
1: 0
2: 7
3: 37
4: 397
Right 1084155498 11:67310646-67310668 CTGTAGGCACAGGCTGGAGAGGG 0: 1
1: 0
2: 2
3: 28
4: 396
1084155485_1084155498 19 Left 1084155485 11:67310604-67310626 CCCCTGAGAGCAGCTGAGATCCA 0: 1
1: 0
2: 1
3: 18
4: 229
Right 1084155498 11:67310646-67310668 CTGTAGGCACAGGCTGGAGAGGG 0: 1
1: 0
2: 2
3: 28
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084155498 Original CRISPR CTGTAGGCACAGGCTGGAGA GGG Intronic
900098313 1:949417-949439 CTTTTGGCCCAGGCTAGAGAAGG - Intronic
900147190 1:1163413-1163435 CTGCAGACACAGGCTGGAGCGGG + Intergenic
900149879 1:1173740-1173762 CTGAGGGCTGAGGCTGGAGAAGG - Intergenic
900218730 1:1495812-1495834 TTGTAGGCACTGGCTAGGGAGGG + Exonic
900226087 1:1534253-1534275 TTGTAGGCACTGGCTAGGGAGGG + Exonic
900434776 1:2624240-2624262 CTGAAGGCCAAGGCTGGAGCAGG + Intronic
900623227 1:3596726-3596748 CTGTAGGAGCAGGGTGGAGACGG - Intronic
900651485 1:3732194-3732216 CTGCAGCCCCAGGCTGGGGATGG - Intronic
900831153 1:4966600-4966622 GTGCAGGCACAGGCAGAAGAAGG + Intergenic
901064650 1:6489060-6489082 CTGTCGGCAGAGCCTGGAGCTGG - Intronic
901633290 1:10658271-10658293 CTGGGGGCACAGGCTGCTGAGGG + Intronic
902147704 1:14417607-14417629 CTGTACGCACAGGCTGTACAAGG + Intergenic
902468367 1:16631561-16631583 CTGGAGACAGAGGATGGAGAGGG - Intergenic
902505774 1:16938430-16938452 CTGGAGACAGAGGATGGAGAGGG + Exonic
902554612 1:17239632-17239654 ATGTAGCCCCAGGCTGAAGACGG + Intronic
902618258 1:17635536-17635558 CAAAAGGCACAGGCTGGAGAGGG - Intronic
902666958 1:17946254-17946276 CAGTAGGCACTGGCTGAATAAGG + Intergenic
903206317 1:21784883-21784905 CTGGAGGCTGAGGCAGGAGAAGG + Intergenic
903230124 1:21916815-21916837 CCTTAGGCCAAGGCTGGAGATGG + Intronic
903438286 1:23368792-23368814 TTGACAGCACAGGCTGGAGAGGG + Intronic
903766340 1:25737270-25737292 CTGCAGCCAATGGCTGGAGAAGG - Intronic
904425481 1:30420027-30420049 CTGTATTCACAGGCAGGAGCAGG + Intergenic
904606062 1:31698367-31698389 GGGTAGGCACAGGATGGAGCAGG + Intronic
905027763 1:34862917-34862939 ATGAAAGCATAGGCTGGAGAGGG - Intergenic
905284175 1:36868460-36868482 CTGTGGGCACAGGGTGCAGAGGG + Intronic
906819695 1:48916382-48916404 CTGCAGGCACAGGGAGGAGAGGG + Intronic
907869690 1:58432078-58432100 GAGTAGGGACAGCCTGGAGACGG - Intronic
910363998 1:86444664-86444686 ATGTAGGCAAAGGAAGGAGAGGG + Intronic
910655422 1:89613659-89613681 CAGTAGTTACAGGCTGGAGTTGG - Intergenic
912460054 1:109824451-109824473 CTGTAAGCACACGCTGGGGGAGG - Intergenic
914802672 1:150972724-150972746 TCTGAGGCACAGGCTGGAGAGGG + Intronic
914997618 1:152558697-152558719 CTGCAGGGAAAGGCTGGAGGTGG + Intronic
915862935 1:159466231-159466253 ATGAAGGCAGAGGTTGGAGAGGG - Intergenic
916029018 1:160860869-160860891 CTATAGACACAGGATGGAGGAGG + Intronic
916568475 1:166004158-166004180 CTGGAGGCTGAGGCAGGAGAAGG + Intergenic
917487284 1:175466756-175466778 GTGTAGGCACAGGTTGCAGTAGG - Intronic
918116770 1:181504540-181504562 CTGTAGGTACATGCTTGGGAAGG - Intronic
918501617 1:185201888-185201910 ATGTAGGCAGAAGCTGGAGTGGG - Intronic
920716335 1:208343806-208343828 AAGGAGGCACAGGATGGAGATGG - Intergenic
921893986 1:220380016-220380038 CTGTGGGCACAGCCTGGGGGTGG + Intergenic
923451300 1:234120030-234120052 CTGGAGGTGCAGGCTGCAGAAGG + Intronic
1063912769 10:10849104-10849126 CTGTAAGAACAGGCTGGCCATGG + Intergenic
1064291330 10:14036593-14036615 CTCTAAGCACATGCTTGAGAGGG + Intronic
1064691947 10:17927375-17927397 CTGGAGGTAAAGTCTGGAGATGG + Intergenic
1065196450 10:23270648-23270670 CAGCAGCAACAGGCTGGAGACGG + Intronic
1066556539 10:36620566-36620588 CTGTAGACACAGGCTTGGCATGG - Intergenic
1067065413 10:43101563-43101585 CTGGAGGCTCAGGATGAAGAGGG - Intronic
1067280882 10:44871760-44871782 CAGTAGGCACTGACTGGGGAGGG - Intergenic
1067445370 10:46338997-46339019 CTGTCGGCAGAGGCAGGGGATGG + Intergenic
1067592003 10:47521734-47521756 CTGTTGGCAGAGGCAGGGGATGG - Intronic
1067639120 10:48029805-48029827 CTGTTGGCAGAGGCAGGGGATGG - Intergenic
1067779584 10:49190038-49190060 CTGTAGACAGTGGCTGGGGACGG + Intergenic
1067874363 10:49990490-49990512 CTGTTGGCAGAGGCAGGGGATGG + Intronic
1067935734 10:50610896-50610918 CTGAAGGCTCAGGCTAGAGATGG + Intronic
1068323372 10:55450494-55450516 CTGTAGGTAAATGCCGGAGAGGG - Intronic
1069906318 10:71734633-71734655 CTGTAGGCAGAGGCAGCAGCAGG - Intronic
1069979614 10:72243073-72243095 TTGTTGGACCAGGCTGGAGAGGG + Intergenic
1069995985 10:72342448-72342470 CTGCAGGCAGAGGCTGGGGCTGG + Intronic
1070541355 10:77417682-77417704 CTATAGGCACAGACTGGATTAGG - Intronic
1070607973 10:77912764-77912786 CTGGAGCCAGAGGCTGCAGATGG - Intronic
1071140858 10:82507661-82507683 CTACTGGGACAGGCTGGAGAAGG + Intronic
1071481945 10:86071200-86071222 CTCTCAGCACAGGCTGGATATGG - Intronic
1072521635 10:96235067-96235089 CTGTGCCCACAGGCTGGGGAGGG - Intronic
1072621205 10:97080607-97080629 CTGTAGGAAGAGGCTGGGGCGGG + Intronic
1073945696 10:108747379-108747401 CTGTAGGGACAAACTGCAGAGGG + Intergenic
1074536942 10:114334805-114334827 CTGCAGGGAGAGGCAGGAGACGG + Intronic
1075603556 10:123788337-123788359 CTGTAGGGAGAGGCTGGTGAAGG - Intronic
1075746562 10:124732194-124732216 GTGTAGGCACAGGCGAGAGCTGG - Intronic
1076936127 10:133568275-133568297 CGGCGGGCTCAGGCTGGAGAAGG - Intronic
1077103539 11:832532-832554 CTGTGGGCAAATGCGGGAGAAGG - Intergenic
1077351534 11:2095319-2095341 CTGGGGACAGAGGCTGGAGAGGG - Intergenic
1077354495 11:2108930-2108952 CTCTTGGCCCAGGCTGGGGATGG - Intergenic
1077479645 11:2807636-2807658 CGGTGGGCACAGGCGGGCGAGGG + Intronic
1078026045 11:7696590-7696612 CTGTAGGCAGATCATGGAGAGGG + Intronic
1081525231 11:43923699-43923721 CTCTATTCACAGGCTGGGGAAGG - Intergenic
1083602201 11:63955689-63955711 CTGTGGCAACAGGCTGGAGCAGG + Exonic
1084155498 11:67310646-67310668 CTGTAGGCACAGGCTGGAGAGGG + Intronic
1084333700 11:68445171-68445193 CTGGAGGCAGAGGCTGCAGTGGG - Intronic
1084650761 11:70487965-70487987 CTCCAGGCACAGGCTGCAGCAGG + Intronic
1087101483 11:94369617-94369639 CTTTAGGCCCAGGCTGGCTATGG + Intergenic
1090272994 11:125400910-125400932 CAGCAGGCAGAGGCTGGAAATGG - Intronic
1090598600 11:128346187-128346209 CTAAATGCACAGACTGGAGATGG - Intergenic
1090949260 11:131458438-131458460 TGGTAGGCAGAGGCTGGGGAAGG - Intronic
1091193170 11:133711110-133711132 ATGTAGGCAAAGGCTTAAGAGGG - Intergenic
1091293190 11:134453818-134453840 CTGTTGGCACTGGGAGGAGATGG + Intergenic
1092905829 12:13099898-13099920 CAGTAGACAAAGGCTGGAGTGGG + Intronic
1094588070 12:31796001-31796023 ATTGAGGCTCAGGCTGGAGACGG - Intergenic
1095214653 12:39533849-39533871 CTATAGCCAAAGGCTAGAGATGG - Intergenic
1097223070 12:57461708-57461730 CCGCAGGCACTGGCTGCAGACGG - Intronic
1097374023 12:58819120-58819142 TTATAGGCACAGGCTGGGGTTGG - Intergenic
1100309546 12:93381516-93381538 CTGTAGGGAAAGGTTGGACAAGG + Intronic
1102542889 12:113635078-113635100 CTGTAGGCACCTGCTGGCCACGG + Intergenic
1104807416 12:131598608-131598630 CTCCCGGCACGGGCTGGAGAAGG + Intergenic
1104815581 12:131643787-131643809 CTGGGGGCACAGCCTGCAGATGG + Intergenic
1105040128 12:132955342-132955364 GTGTTGGCTCAGGCTGGGGATGG + Intronic
1105609011 13:21951288-21951310 CAGCAGGCACTGGCTGGAAAGGG + Intergenic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1108520192 13:51239979-51240001 CTGTAGTCCGAGGCTGGAGCAGG - Intronic
1108649539 13:52463041-52463063 CTGGAGGCTGAGGCAGGAGAAGG - Intronic
1109230724 13:59753976-59753998 CAGTAGGAGGAGGCTGGAGATGG - Intronic
1110031949 13:70627171-70627193 CTGGAGGCTGAGGCAGGAGAAGG - Intergenic
1111187709 13:84761689-84761711 CGGTTGCCAGAGGCTGGAGAGGG - Intergenic
1111636243 13:90907762-90907784 TTATAGGCACAGGATGGAGTTGG + Intergenic
1111742118 13:92217541-92217563 TTGTAGCCACAGATTGGAGATGG - Intronic
1113822525 13:113224917-113224939 CTGTCGGTACAGGCAGCAGATGG + Intronic
1113855100 13:113439411-113439433 CTGTAGGCCCAGGCTGGGCACGG - Intronic
1118513988 14:66507532-66507554 TTGCAGGCACTGACTGGAGATGG + Exonic
1118891273 14:69911242-69911264 CTGGGGGTAAAGGCTGGAGATGG + Intronic
1119037445 14:71242289-71242311 CTGCAGGGAGAGGCTGGACAAGG - Intergenic
1120768347 14:88352644-88352666 TTGTAGGGACAGGCTGGACTCGG - Intergenic
1121025354 14:90611669-90611691 TTATAGGCACAAGCTAGAGAGGG - Intronic
1121338389 14:93090877-93090899 CTGGAGGCGCAGGTTGGTGATGG - Intronic
1121519938 14:94579139-94579161 CAGCACACACAGGCTGGAGACGG + Intronic
1121765804 14:96484374-96484396 GCGTAGGAACAGACTGGAGATGG - Intronic
1121991977 14:98567085-98567107 CAGGAGGCAGAGGCTAGAGATGG - Intergenic
1122134787 14:99626615-99626637 CTGTAGACACAGGCCTGAGAAGG + Intergenic
1122817527 14:104320935-104320957 CTCTCGGCAGAGGCTGGGGAAGG + Intergenic
1122889867 14:104727277-104727299 ATGTAGGCTCAGCCTGGAGAAGG - Intronic
1122902586 14:104787981-104788003 CAGGAGGCACAGGCTGGTGGAGG - Intronic
1202850093 14_GL000225v1_random:10903-10925 CTGTAGGCAGAGCCTAGAAAAGG + Intergenic
1202851955 14_GL000225v1_random:26562-26584 CTGTAGGCAGAGCCTTGACAAGG - Intergenic
1202855440 14_GL000225v1_random:48020-48042 CTGTAGGCAGAGGCTAGACAAGG + Intergenic
1202855607 14_GL000225v1_random:49659-49681 CTGTAGGCAGAGACTTGAAAAGG + Intergenic
1202856826 14_GL000225v1_random:57247-57269 CTGTAGGCAGAGCCTAGACAAGG + Intergenic
1202858552 14_GL000225v1_random:65774-65796 CTGTAGGCAGAGCCTAGACAAGG - Intergenic
1202862684 14_GL000225v1_random:92775-92797 CTGTAGGCAGAGCCTAGACAAGG - Intergenic
1202863723 14_GL000225v1_random:101884-101906 CTGTGGGCACAGCCTAGACAAGG - Intergenic
1202864704 14_GL000225v1_random:108288-108310 CTGTAGGCAGAGCCTAGACAAGG + Intergenic
1202865893 14_GL000225v1_random:116842-116864 CTGTAGGCAGAGCCTAGACAAGG - Intergenic
1202866292 14_GL000225v1_random:120532-120554 CTGTAGGCAGAGCCTGGACAAGG - Intergenic
1202869166 14_GL000225v1_random:143905-143927 CTGTAGACAGAGGCTAGAAAAGG - Intergenic
1124441110 15:29687177-29687199 CTTTGTGCAAAGGCTGGAGAAGG + Intergenic
1124621698 15:31277643-31277665 CTGCAGGCCCAGGCTGGACCAGG - Intergenic
1124721774 15:32116933-32116955 CTGATAGCAGAGGCTGGAGAGGG + Intronic
1124878502 15:33619695-33619717 CTGCAGGCCCAAGCTGGGGAAGG - Intronic
1125828099 15:42692800-42692822 CTGGAGGCACAGGGTGGGTAAGG - Exonic
1127209596 15:56759444-56759466 CTTTAGGCACTGTTTGGAGATGG + Intronic
1129413255 15:75361240-75361262 GGGTAGGGGCAGGCTGGAGAGGG - Intronic
1129661355 15:77554722-77554744 CTGGGGGCTCAGGCTGAAGAGGG + Intergenic
1129672027 15:77612849-77612871 CTGGCAGCACTGGCTGGAGAAGG - Intergenic
1129826450 15:78637950-78637972 CTGTAGCCCCAGGCTAGAGCTGG + Intronic
1129893653 15:79088706-79088728 GGGTAGACACTGGCTGGAGAGGG + Intronic
1129906979 15:79195399-79195421 CTGTGGGCACATGCTGAGGAGGG - Intergenic
1130147155 15:81282906-81282928 TTGTGGGCACTGGCTGGGGAGGG + Intronic
1131074658 15:89487358-89487380 CTGCTGGCCCAGGCTGGAGGTGG + Intronic
1131149312 15:90037014-90037036 CTCCAGGGTCAGGCTGGAGATGG + Intronic
1132205370 15:99982818-99982840 CTGTGGGCACCTGCTGGGGAGGG - Intronic
1132873866 16:2127358-2127380 ATGTAGGCACAAGCAGGAGTGGG + Intronic
1133245094 16:4443308-4443330 CTGGAGCCCCAGGCTGGAGGAGG + Intronic
1133635936 16:7665326-7665348 CTGTAGTCACCAGCTGCAGAGGG + Intronic
1134047869 16:11114574-11114596 CTGCAGGCAGAGGCTTTAGAGGG + Intronic
1134278847 16:12800686-12800708 GTGTGGGCTGAGGCTGGAGAGGG - Intronic
1135664801 16:24326725-24326747 CTCTCTGCACAGGCTGAAGAGGG + Intronic
1137035025 16:35562697-35562719 CTGTAGGCACAGCCTACAGTTGG - Intergenic
1137621582 16:49879938-49879960 CTACAGCCACAGGCTGGGGAGGG + Intergenic
1139588193 16:67917739-67917761 CTGTGGGCACAGGCAGGGGGAGG + Intronic
1139678350 16:68540274-68540296 GTCTAGGAAGAGGCTGGAGATGG + Intronic
1140262936 16:73396309-73396331 ATGTAGGCTCAAACTGGAGAAGG + Intergenic
1140268329 16:73439982-73440004 GTGTAGGCACGGGGTTGAGATGG + Intergenic
1140399733 16:74661326-74661348 CAGCAGGAACAGGCTGGAGGAGG + Exonic
1140721033 16:77772407-77772429 GTGTAGGCATAGGCTGGGCAAGG + Intergenic
1142071418 16:88092867-88092889 CAGAAGGCACAGGCTGGGGCAGG - Intronic
1142702759 17:1674126-1674148 CCGGAGGCTGAGGCTGGAGAAGG - Intronic
1143017303 17:3897835-3897857 CTGCAGGCCCAGGGTGGAGCTGG + Exonic
1143403560 17:6661071-6661093 CTGTAGGGAGAGGCAGGAGTGGG + Intergenic
1144701505 17:17343867-17343889 CTGTAGAGACAGCCTGGAGCTGG + Intronic
1144728305 17:17512655-17512677 CTGTGGGCAGGGGATGGAGAGGG + Intronic
1145907713 17:28525361-28525383 CTGTATGCTAAGGCTGGGGAGGG - Intronic
1147174740 17:38647848-38647870 CTGTAGGGACAGGTTTGGGATGG + Intergenic
1148438282 17:47698677-47698699 CGGTGGGCTCAGGTTGGAGAAGG - Exonic
1148699913 17:49581134-49581156 GTGAAGGAACAGGCTGGAGTGGG + Intronic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1152586186 17:81190494-81190516 CTGTAGACAGAGGCTGGTGTGGG - Intronic
1152725066 17:81941124-81941146 CAGGAAGCACAGGCTGTAGACGG + Exonic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1154389313 18:13922923-13922945 CTGGAGGGAGAGGCTGGACAGGG + Intergenic
1156625540 18:38903200-38903222 CTGTTGCCACAGGATGGAGCGGG - Intergenic
1159207981 18:65278847-65278869 ATCCAGGAACAGGCTGGAGAGGG + Intergenic
1159842144 18:73411694-73411716 TTGTTGGGACTGGCTGGAGAAGG + Intergenic
1160215655 18:76927419-76927441 CTGTAAGGACAGGCCTGAGATGG - Exonic
1160785805 19:899839-899861 CGGAAGGCACAGGCAGGAGGTGG - Intronic
1160803478 19:980815-980837 CTGCTGCCACAGGCAGGAGAGGG - Intergenic
1160879515 19:1313115-1313137 CTGTATGCCCATGCTGCAGAGGG - Intergenic
1162069258 19:8143927-8143949 CTGTAGTCTCAGGCTGAAGTGGG - Intronic
1162450635 19:10752338-10752360 CTGTGGGCACAGGCAGGAGAAGG - Intronic
1162574431 19:11490737-11490759 GTGTAGGCAGAAGCTGCAGATGG - Intronic
1162854698 19:13459399-13459421 CTGGAGGCAAAGGCTGAAGCTGG - Intronic
1162966154 19:14157074-14157096 CTCCAGGCACAGCCAGGAGAAGG + Exonic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163741806 19:19018878-19018900 CTGTAGTCACAGGTGAGAGAAGG + Intronic
1164403386 19:27919175-27919197 CTGTAGTCACAGCCTGGTCATGG - Intergenic
1165394133 19:35555113-35555135 GTGTGGGCACAGGAGGGAGAGGG - Intronic
1166288819 19:41848763-41848785 CAGAGGGCACAGGCTGGAGTTGG - Intronic
1166439570 19:42800477-42800499 CTGCAGGCAAAGTCTGAAGATGG - Intronic
1166457609 19:42956021-42956043 CTGCAGGCAAAGTCTGAAGATGG - Intronic
1166467934 19:43050458-43050480 CTGCAGGCAAAGTCTGAAGATGG - Intronic
1166474552 19:43111229-43111251 CTGCAGGCAAAGTCTGAAGATGG - Intronic
1166488528 19:43236325-43236347 CTGCATGCAAAGGCTGAAGATGG - Intronic
1166495201 19:43296799-43296821 CTGCAGGCAAAGTCTGAAGATGG - Intergenic
1167497724 19:49829350-49829372 CTGGAGGCAGAGGCTGCAGTGGG - Intronic
1167609854 19:50501809-50501831 CTGCAGGCACAGAATGGAGGGGG - Intergenic
1167626381 19:50592476-50592498 CTGTAGGCACAGGGAGGAGCAGG - Intergenic
1167861391 19:52286907-52286929 CAGTAGGCAGAGGCTGCAGTGGG - Intronic
925149670 2:1606530-1606552 CTGGAGGCTGAGGCTGGAAAGGG + Intergenic
925258901 2:2512657-2512679 CCATGGGCACTGGCTGGAGAGGG - Intergenic
925574879 2:5350028-5350050 TTGTAATCACAGGCTGGTGAGGG + Intergenic
925920576 2:8634991-8635013 GTGGAGGCAGAGGCTGGAGAGGG - Intergenic
926500085 2:13642851-13642873 TTGTAGGCACAGGATGGGGGTGG + Intergenic
927357316 2:22187963-22187985 ATGTCGGCACAGGCCAGAGAGGG - Intergenic
929598140 2:43188844-43188866 CTGGAAGAACAGGCTGCAGAGGG + Intergenic
931800884 2:65756681-65756703 CTGAAGGTACAAGCTGGTGATGG + Intergenic
932366528 2:71156687-71156709 CTGTAGCCTCAGGCTAGAGCTGG + Intergenic
932463210 2:71896688-71896710 CAGCAGGGACAGGATGGAGAGGG + Intergenic
932974348 2:76579703-76579725 CAGTAGCCACAGTCTGGATAAGG + Intergenic
933723617 2:85413812-85413834 CTGTAAGAAAAGGCGGGAGAGGG - Intronic
934144800 2:89081258-89081280 ATGTGGGCTCAGGTTGGAGAAGG + Intergenic
934224457 2:90119293-90119315 ATGTGGGCTCAGGTTGGAGAAGG - Intergenic
935844982 2:107155824-107155846 CTCAAGGCAGAGGCTGGAGCTGG - Intergenic
936093152 2:109513765-109513787 CTGTAGCCACAGGCTGGCTCTGG - Intergenic
936260665 2:110957572-110957594 GTGAAGACACAGGCAGGAGATGG - Intronic
937970036 2:127542260-127542282 CTGTGGAGACAGGCTGGAGCAGG + Intronic
938030176 2:127985681-127985703 CCGTGGGCACAGGCTGGGGGTGG - Intronic
938706125 2:133928924-133928946 CTGAAGGCACAGGGTGAAAATGG - Intergenic
940289370 2:152063511-152063533 TTGCATGCACAGGCTGGAGCTGG - Intronic
943498286 2:188652367-188652389 CTGTAGGGAAAGGGTGGAGAAGG + Intergenic
943642971 2:190379207-190379229 CTGTTGTCACAGTCTGGAGATGG - Intergenic
946892832 2:224296148-224296170 CTGTAGGTAGAGGATGGGGATGG - Intergenic
947112053 2:226729165-226729187 CTGTGGTCACAGGCTGCTGAGGG - Intergenic
947759488 2:232593423-232593445 CAGAGGGCACAAGCTGGAGAAGG + Intergenic
948212547 2:236205327-236205349 CTGTAGCCTAAGGCTGGAGTGGG - Intronic
948694303 2:239725494-239725516 CTGTAGCCACAGGACGAAGAGGG - Intergenic
948803200 2:240442045-240442067 CTGAGGCCACAGGCAGGAGAGGG - Intronic
948805057 2:240450314-240450336 CTGCAGGCAAAGGCTGAAGCAGG - Intronic
1168770044 20:408778-408800 AGGTGGGCACAGGCTGGAGGTGG + Exonic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169408933 20:5350514-5350536 CTGAGGGGACAGGGTGGAGAGGG - Intergenic
1170906920 20:20524462-20524484 CTGTGGACACGGGGTGGAGAAGG + Exonic
1170908344 20:20537992-20538014 CTGTAGGCTCAGTCTGGACCTGG - Intronic
1171012289 20:21515210-21515232 CTCTAGCCAGAGGCTGGAGAGGG - Intergenic
1171488604 20:25501085-25501107 CTCTGAGCACAGGCTGGGGAGGG - Intronic
1172847658 20:37939568-37939590 CTCTAAGCACAATCTGGAGAAGG - Intronic
1173017330 20:39237521-39237543 CTGCAGGCACCTGCTGGAGTAGG - Intergenic
1173850242 20:46213228-46213250 CTGCTGGCAGAGGCTGGGGAAGG - Intronic
1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG + Intergenic
1174403395 20:50288462-50288484 CTCTGGGCACAGGAGGGAGATGG + Intergenic
1175402512 20:58708562-58708584 CTGTCGGAAGAGGCTGGAGGAGG + Intronic
1176256665 20:64156608-64156630 CTGGGGGCACCGGCAGGAGAAGG - Intronic
1177856525 21:26406252-26406274 GTGGCTGCACAGGCTGGAGAAGG + Intergenic
1178589335 21:33896190-33896212 CTGTACCCCAAGGCTGGAGAGGG + Exonic
1178908281 21:36653960-36653982 CAGCAGGCCCAGGCTGGGGAGGG - Intergenic
1179229861 21:39491900-39491922 TTGGAGGCACAGACTGGAGCTGG + Intronic
1179886607 21:44316875-44316897 CAGGAGGCACAGGCTGGTGGGGG - Intronic
1180713124 22:17853409-17853431 CAGCAGGCACAGGCCAGAGAGGG + Intronic
1181407853 22:22697535-22697557 CAGTAGAGACAGGCTGGAGGTGG + Intergenic
1181455631 22:23058771-23058793 ATGAAGGCACAGGCAGAAGAGGG + Intergenic
1181492493 22:23269245-23269267 AGGCAGACACAGGCTGGAGAAGG - Intronic
1181664168 22:24379974-24379996 CTGGAGGCTGAGGCAGGAGAAGG - Intronic
1181816050 22:25437631-25437653 GAGTCAGCACAGGCTGGAGAGGG + Intergenic
1182407872 22:30153184-30153206 CAGTAAGAACAGGCTGGAAAGGG - Intronic
1183433432 22:37779785-37779807 CTGCGGGGACAGGCTGGAGCTGG + Intergenic
1183462468 22:37960501-37960523 CTGGAGGCTGAGGCAGGAGAAGG - Intronic
1184191519 22:42898229-42898251 AGGTGGGCACAGCCTGGAGAAGG - Intronic
1184388341 22:44188810-44188832 CTGCAGGCACAGGCTGATCAAGG + Intronic
1184715608 22:46280171-46280193 CTGCAGCCCCAGGCTGGTGAGGG + Intronic
1185161557 22:49232929-49232951 CTGGGGGCACAGGCTGGGGCAGG + Intergenic
1185340169 22:50287572-50287594 CTGTTGGGACAGGCAGGGGAGGG - Intronic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
949171968 3:1010803-1010825 CTGGAGGCTGAGGCAGGAGAAGG + Intergenic
949261165 3:2104611-2104633 TTGTAGGCACAGCCTGGAAGTGG + Intronic
950467162 3:13162348-13162370 CTGCAGGCTCAGGAAGGAGATGG - Intergenic
950482872 3:13255346-13255368 CTGTTGCCCCAGGTTGGAGAGGG - Intergenic
950873525 3:16249660-16249682 GTGCAGGGACAGGCTGGGGAGGG + Intergenic
951796799 3:26548268-26548290 CTGTAGGAACAGGCAGCAGTAGG + Intergenic
951887508 3:27538732-27538754 CGGCAGGCCCAGGATGGAGAAGG - Intergenic
952387408 3:32852234-32852256 CCGGAGGCACATCCTGGAGAAGG + Intronic
952968820 3:38637856-38637878 CTGTAGGCACTGTCTGAAGTGGG + Intronic
953755545 3:45642995-45643017 CTGTTGGCACACCCTGGAGTGGG + Intronic
954118090 3:48478311-48478333 CTGTAGGCCCAGGCAGGTGTGGG - Intronic
955198752 3:56830488-56830510 CTGTAGGCACTGGTTGCAGCAGG - Intronic
955466330 3:59240897-59240919 ATGTATACACAGTCTGGAGAAGG + Intergenic
955649785 3:61181613-61181635 CTTTAGGCAGAGCCAGGAGAGGG - Intronic
958165847 3:89877222-89877244 CTGAAGCCAGAGGCTGGAGGAGG + Intergenic
961796835 3:129415214-129415236 GTGGAGGCACAGGATGGGGAGGG + Intronic
962209106 3:133461572-133461594 CTGGAGGCACAGGGTTGAAATGG + Intronic
962364420 3:134768361-134768383 CTGTAGGCAAAGTCTGCAGCAGG - Intronic
962625395 3:137220846-137220868 ATGTCAGCAGAGGCTGGAGATGG + Intergenic
962808205 3:138941489-138941511 CTGGAAGCCAAGGCTGGAGATGG - Intergenic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
963080096 3:141383760-141383782 TGGCAGGCACAGGCTGGAGAAGG - Intronic
964763906 3:160159960-160159982 CTGTAGGCAGAAGCTGAGGATGG - Intergenic
965838415 3:172876762-172876784 CAGCAGGCTCAGGCTGCAGATGG - Intergenic
965927907 3:174006007-174006029 GTGAAGGCAGAGGCAGGAGAGGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
966756767 3:183378455-183378477 GTTGAGGCCCAGGCTGGAGAGGG + Intronic
967283256 3:187843031-187843053 GTGTAGGCAGAGCCTGGAGGAGG + Intergenic
967948169 3:194820460-194820482 CTGTGGTCACAGGCTAGACAGGG + Intergenic
968487067 4:867868-867890 CTTGAGGCAGAGGCTGGAGGTGG - Intronic
968790990 4:2661740-2661762 CTGTGTGCCCAGGCTGAAGATGG + Intronic
969520497 4:7675354-7675376 CTGGGGGCACAGTCTGGAGGGGG - Intronic
970147843 4:13055815-13055837 CTTTTGGCACTTGCTGGAGAAGG + Intergenic
970195450 4:13547041-13547063 CTGTAGGCAGAGCCGGGAGTTGG + Intergenic
973942679 4:55926337-55926359 CAGCAGGCCCAAGCTGGAGAAGG - Intergenic
975730147 4:77329896-77329918 GTATATGCAGAGGCTGGAGAAGG + Intronic
980174065 4:129324069-129324091 ATGTATGCAAAGGCTGGAGCTGG - Intergenic
980481610 4:133395167-133395189 CTGGAGCCACGGGCTGGAGAGGG + Intergenic
980795058 4:137671905-137671927 AAATAGGCACTGGCTGGAGAAGG + Intergenic
980863542 4:138527809-138527831 CTCTAGTCACTGGTTGGAGATGG + Intergenic
981956037 4:150475604-150475626 CTGTAGGCTCAGGCTGGGCTTGG + Intronic
985469673 5:32293-32315 CCCCAGGCACAGGCAGGAGAGGG + Intergenic
985674776 5:1225390-1225412 ACGTCGGCAGAGGCTGGAGACGG + Exonic
985675582 5:1229841-1229863 CTCACGGTACAGGCTGGAGATGG + Intronic
987319513 5:16755269-16755291 CTGGAGGCTGAGGCAGGAGAAGG - Intronic
987427737 5:17792642-17792664 CTGGAGGCTGAGGCAGGAGAAGG + Intergenic
988437050 5:31188785-31188807 CTGTAGACAGAAGCTGGAGATGG - Intergenic
990121984 5:52466007-52466029 CTGTAGGCAATGGCTACAGAAGG + Intergenic
990285447 5:54296909-54296931 TTGTATGGAAAGGCTGGAGAGGG + Intronic
992342891 5:75844335-75844357 CTGTAGTCAAAGGCTGGAGCTGG - Intergenic
992994072 5:82315473-82315495 CTGTCTGCACTGGCTGGAGGCGG + Intronic
993510717 5:88768382-88768404 CTGGAGGCAAAGGCTGTAGTAGG + Intronic
994550276 5:101225736-101225758 GTGAAGGCACAGGCAGAAGATGG + Intergenic
995837111 5:116409961-116409983 CTGGAGGCACTGGCTGCAGTGGG + Intronic
996297232 5:121935482-121935504 CAGTAGGCAGAGGCAGAAGAAGG - Intergenic
997757449 5:136412611-136412633 CTTTAGGCACAAGATGGAAAGGG + Intergenic
998486361 5:142505937-142505959 CTGTAGGCAGGGTCTGGAGGCGG + Intergenic
999321255 5:150616519-150616541 GTGGAGGCAAAGGGTGGAGATGG - Intronic
1000161066 5:158598286-158598308 CTGGAGGCTGAGGCAGGAGAAGG - Intergenic
1001405571 5:171474729-171474751 AGGGAGGGACAGGCTGGAGAAGG - Intergenic
1002271286 5:178074252-178074274 CCGTGGGCACAGGCTGGGGGTGG - Intergenic
1002484362 5:179524267-179524289 CAGGAGGCACAGGCTGCAGCCGG - Intergenic
1002500213 5:179643221-179643243 CAGGAGGCACAGGCTGCAGCCGG + Intronic
1002501759 5:179651540-179651562 CAGGAGGCACAGGCTGCAGCCGG - Intergenic
1002769496 6:278677-278699 CTGTGGGCAGAGCCTGGAGGTGG + Intergenic
1003224637 6:4192387-4192409 CTGTGGCAACAGGCTGGAGCAGG + Intergenic
1003569889 6:7248788-7248810 CTGCAGCCACAGGGAGGAGAAGG + Exonic
1004324800 6:14665036-14665058 CTGGAGAAACAGGCTGGAAAGGG - Intergenic
1005183885 6:23140210-23140232 TTGTAATCACAGGCAGGAGAGGG + Intergenic
1005759155 6:28951753-28951775 CGGGAGGCTGAGGCTGGAGAAGG + Intergenic
1005821446 6:29602919-29602941 CAGTGGGCACACGCAGGAGAGGG + Exonic
1007006195 6:38365449-38365471 CTGAAGGTACAGGCTGGATGTGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1010313172 6:74412300-74412322 CTGTAGGCATAGGCTTGTGCAGG - Intergenic
1010501643 6:76609033-76609055 TTATAGGCACAGGATGGGGATGG - Intergenic
1010870496 6:81031385-81031407 CTGAAGTCAAAGGCTTGAGAAGG + Intergenic
1012662984 6:101927093-101927115 CTGTAGGCAGAATCTGGAGCTGG + Intronic
1013112968 6:107078981-107079003 CTATAGGCACAGGATAGAAATGG - Intronic
1013172382 6:107648417-107648439 CTGTAGTCACAGTGGGGAGAGGG + Intronic
1013445201 6:110218921-110218943 CAGTGGGCACAGACTGGAAAAGG - Intronic
1014348019 6:120300112-120300134 CTGTAGGGAGGGGCTGGAGGTGG + Intergenic
1015714680 6:136180378-136180400 CTTAAGGCAGAGGCTGGAGGAGG + Intronic
1016798430 6:148143109-148143131 CTGAAGGGACTGGCTGGGGAAGG + Intergenic
1017018284 6:150118711-150118733 CTGCGGGCACAGCCTGGGGAAGG + Intergenic
1018800394 6:167217758-167217780 TAGAAGGCACAGGCTGGTGAAGG - Intergenic
1019469466 7:1211058-1211080 TTCTATGCTCAGGCTGGAGAAGG - Intergenic
1020175603 7:5879622-5879644 CTGTTGGCAAAGTGTGGAGAAGG - Intergenic
1020350160 7:7210577-7210599 ATATATGCAGAGGCTGGAGAAGG + Intronic
1020732141 7:11893480-11893502 ATGGATGCATAGGCTGGAGATGG + Intergenic
1021015422 7:15525753-15525775 CAGGAGCCCCAGGCTGGAGAGGG + Intronic
1022519695 7:30998268-30998290 CCCTAGACACAGGCTAGAGATGG - Intergenic
1026155340 7:67821154-67821176 CGGGAGGCAGAGGCAGGAGATGG - Intergenic
1026193510 7:68151164-68151186 CTGGAGGCAGAGGCTGCAGTGGG + Intergenic
1026969688 7:74460554-74460576 CTCGAGCCACAGGCTGGAGGAGG - Intronic
1027375314 7:77542305-77542327 CTCAAGGAGCAGGCTGGAGAAGG - Intronic
1029083228 7:97991344-97991366 CTGTTGGCAAAGTGTGGAGAAGG + Intergenic
1029216195 7:98951914-98951936 CAGGAGACACAGCCTGGAGAAGG - Intronic
1030547110 7:110909749-110909771 CTGTAGGTAGAGGATAGAGATGG - Intronic
1031469935 7:122156789-122156811 ACGTAGGCAGAGGCAGGAGATGG + Intergenic
1031740838 7:125428258-125428280 CTGTTCTCACAGACTGGAGAAGG + Intergenic
1032185933 7:129726164-129726186 CAGTAGGCACAGAATAGAGATGG - Intronic
1032197545 7:129798317-129798339 CTGCAGGCAGAGGCTTGAGGAGG + Intergenic
1034002906 7:147436077-147436099 CTGTAGGATGAAGCTGGAGAGGG - Intronic
1034982869 7:155489768-155489790 CTGTAGGCACTGCCCGGGGAGGG + Intronic
1039518766 8:38153788-38153810 GCCTAGGCACAGGCTGGCGACGG - Intergenic
1039786642 8:40840169-40840191 CTGAAGGGACAGGCTGCTGAAGG - Intronic
1039873593 8:41567330-41567352 CTGCGGGCACAGCCTGAAGAGGG + Intergenic
1041449265 8:57990038-57990060 CTGTAGCCACAGGCAGCTGATGG - Intergenic
1045252469 8:100493394-100493416 TTCTGGGCACAAGCTGGAGAAGG + Intergenic
1045290112 8:100825791-100825813 CTGGAGGCAAAGGCTGCAGGAGG + Intergenic
1045329148 8:101140466-101140488 CAGTGGGCAGAGGCTAGAGATGG + Intergenic
1045472639 8:102526045-102526067 CTGTAGTCCCAGGCTGCAGCAGG - Intergenic
1046165232 8:110424973-110424995 CTATAGCCACAGGCTAGAAAAGG - Intergenic
1047732599 8:127738777-127738799 CTGCAGGTACAAGCTGGAGGTGG - Exonic
1048521330 8:135158171-135158193 GTGTAGGCCCAGGGTGGAAATGG - Intergenic
1049090108 8:140508349-140508371 CAGTTTGCACAGGCTGGAGGTGG - Intergenic
1049235643 8:141510929-141510951 CTGTGGCCCCAGGCAGGAGAAGG + Intergenic
1049496449 8:142936497-142936519 TTTAAGGCTCAGGCTGGAGATGG - Intergenic
1049545803 8:143229961-143229983 CTGTGGGAACTCGCTGGAGAAGG + Intergenic
1049963174 9:755745-755767 CAGTGGGAACAGGCTGGAGATGG - Intergenic
1050835251 9:10069205-10069227 GAATAGACACAGGCTGGAGATGG + Intronic
1051278326 9:15417983-15418005 ATATATGCAGAGGCTGGAGAAGG - Intergenic
1051739463 9:20237532-20237554 CTGAAGACACAGACTAGAGAAGG + Intergenic
1052592379 9:30514853-30514875 CTTTGAGCAAAGGCTGGAGATGG - Intergenic
1052978803 9:34432082-34432104 CTGCAGCCACAGCCAGGAGATGG + Intronic
1056270992 9:84947965-84947987 TTGTGGGCACAGGCTGGAGAAGG + Intronic
1057184560 9:93049690-93049712 CTGTACGGACAGGCTGGGGGAGG + Intergenic
1057184569 9:93049734-93049756 CTGTAGGGACAGGCTGGGGGAGG + Intergenic
1057453096 9:95182962-95182984 ATGTAGGGGCAGGCTGGAGTAGG - Intronic
1057509177 9:95663505-95663527 ATTTAGGCACAGTCTTGAGAGGG + Intergenic
1059952275 9:119478004-119478026 CTGTGGGCACAGGCCAGAGGTGG + Intergenic
1060233128 9:121840344-121840366 ATGGATGCACAGGCTGGAGGGGG + Intronic
1060742553 9:126109128-126109150 CTATAGGCATAGGCTGGTTATGG + Intergenic
1060962587 9:127691546-127691568 CTGTGGACACAGGCTGGGGAGGG - Exonic
1062366188 9:136210268-136210290 CTCAATGCACAGGCTGGAGGTGG + Intronic
1062394157 9:136346009-136346031 CTGTGGCCACAGGGTGGCGATGG + Intronic
1062434913 9:136542704-136542726 CAGTCGGCACAGGCAGGAGCCGG + Intronic
1062460647 9:136661303-136661325 CTGGAGGGACAGGCTGGCCAGGG + Intronic
1203735707 Un_GL000216v2:137237-137259 CTGTAGACAGAGGCTAGAAAAGG + Intergenic
1203736270 Un_GL000216v2:142582-142604 CTGTAGGCAGAGACTAGAAAAGG + Intergenic
1203737499 Un_GL000216v2:150634-150656 CTGTAGGCAGAGAGTGGAAAAGG + Intergenic
1203738048 Un_GL000216v2:155694-155716 CTGTAGGCAGAGCCTGGACAAGG + Intergenic
1203738442 Un_GL000216v2:159315-159337 CTGTAGGCAGAGCCTAGACAAGG + Intergenic
1203739643 Un_GL000216v2:167934-167956 CTGTAGGCAGAGCCTAGACAAGG - Intergenic
1203740599 Un_GL000216v2:174129-174151 CTGTGGGCACAGCCTAGACAAGG + Intergenic
1190138167 X:47816134-47816156 CTGTAGGAAATGCCTGGAGAGGG + Intergenic
1190876896 X:54466367-54466389 CTGTGGTCACAGTCTGGTGAGGG + Intronic
1192318231 X:70067863-70067885 CAGGGGGCACAGGCTGGGGAGGG + Intergenic
1192723491 X:73724439-73724461 CTGGAGGCCCTGGCTGGAAAAGG + Intergenic
1192757648 X:74063437-74063459 GTGAAGGCACAGGGTGAAGATGG - Intergenic
1195333187 X:103823253-103823275 CTATAGGCATAGGCAGGATAGGG + Exonic
1195550167 X:106160185-106160207 GTGTGGGAACAGGGTGGAGAGGG - Intergenic
1195570837 X:106397001-106397023 CTGCAGGCACCGAGTGGAGAGGG + Intergenic
1197614453 X:128675782-128675804 CTGAAGGCACAGTTTGGAAAGGG - Intergenic
1198312120 X:135434017-135434039 CTGGAGACAGAGGATGGAGAGGG + Intergenic
1199504410 X:148545164-148545186 GTTGAGGAACAGGCTGGAGAGGG + Intronic
1201125110 Y:10905886-10905908 CTGTAGGCAGAGACTAGAGAAGG - Intergenic
1202623819 Y:56837341-56837363 CTGTAGGCAGAGCCTAGACAAGG - Intergenic
1202624165 Y:56840548-56840570 CTGTAGGCAGAGCCTAGAAATGG - Intergenic