ID: 1084159785

View in Genome Browser
Species Human (GRCh38)
Location 11:67340899-67340921
Sequence TTGGCCATGGCCAGGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2573
Summary {0: 1, 1: 6, 2: 47, 3: 391, 4: 2128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084159785_1084159790 14 Left 1084159785 11:67340899-67340921 CCACTGCACCTGGCCATGGCCAA 0: 1
1: 6
2: 47
3: 391
4: 2128
Right 1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1084159785_1084159789 13 Left 1084159785 11:67340899-67340921 CCACTGCACCTGGCCATGGCCAA 0: 1
1: 6
2: 47
3: 391
4: 2128
Right 1084159789 11:67340935-67340957 ACAGTGCCAACGTAATTAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 87
1084159785_1084159792 21 Left 1084159785 11:67340899-67340921 CCACTGCACCTGGCCATGGCCAA 0: 1
1: 6
2: 47
3: 391
4: 2128
Right 1084159792 11:67340943-67340965 AACGTAATTAAGTGGGTAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084159785 Original CRISPR TTGGCCATGGCCAGGTGCAG TGG (reversed) Intronic
Too many off-targets to display for this crispr