ID: 1084159786

View in Genome Browser
Species Human (GRCh38)
Location 11:67340907-67340929
Sequence AAAATAATTTGGCCATGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 424}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084159786_1084159793 28 Left 1084159786 11:67340907-67340929 CCTGGCCATGGCCAAATTATTTT 0: 1
1: 0
2: 4
3: 48
4: 424
Right 1084159793 11:67340958-67340980 GTAAAAGGTCTTTGAGCAAATGG 0: 1
1: 0
2: 0
3: 23
4: 201
1084159786_1084159790 6 Left 1084159786 11:67340907-67340929 CCTGGCCATGGCCAAATTATTTT 0: 1
1: 0
2: 4
3: 48
4: 424
Right 1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1084159786_1084159794 29 Left 1084159786 11:67340907-67340929 CCTGGCCATGGCCAAATTATTTT 0: 1
1: 0
2: 4
3: 48
4: 424
Right 1084159794 11:67340959-67340981 TAAAAGGTCTTTGAGCAAATGGG 0: 1
1: 0
2: 2
3: 26
4: 239
1084159786_1084159795 30 Left 1084159786 11:67340907-67340929 CCTGGCCATGGCCAAATTATTTT 0: 1
1: 0
2: 4
3: 48
4: 424
Right 1084159795 11:67340960-67340982 AAAAGGTCTTTGAGCAAATGGGG 0: 1
1: 0
2: 0
3: 28
4: 287
1084159786_1084159789 5 Left 1084159786 11:67340907-67340929 CCTGGCCATGGCCAAATTATTTT 0: 1
1: 0
2: 4
3: 48
4: 424
Right 1084159789 11:67340935-67340957 ACAGTGCCAACGTAATTAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 87
1084159786_1084159792 13 Left 1084159786 11:67340907-67340929 CCTGGCCATGGCCAAATTATTTT 0: 1
1: 0
2: 4
3: 48
4: 424
Right 1084159792 11:67340943-67340965 AACGTAATTAAGTGGGTAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084159786 Original CRISPR AAAATAATTTGGCCATGGCC AGG (reversed) Intronic
900286890 1:1905992-1906014 AAAATTAGCTGGGCATGGCCGGG - Intergenic
901553131 1:10010877-10010899 AAAATTAGCTGGGCATGGCCGGG - Intronic
902228555 1:15012624-15012646 AAAATAATGGGATCATGGCCCGG + Intronic
902321935 1:15673994-15674016 AAAATAAATTAGCCGGGGCCGGG - Intergenic
902552354 1:17226626-17226648 AAAAAAATATGGCCAAGGCTGGG + Intronic
903111733 1:21140603-21140625 TAAATAATTTTGCCAAGGCCAGG - Intronic
903381323 1:22898914-22898936 AAAATAGTTTGGGGCTGGCCAGG + Intronic
903591752 1:24461569-24461591 TTAAAAATTTGGCCTTGGCCGGG + Intronic
904081913 1:27877620-27877642 AAAATAATTGAGCTCTGGCCGGG - Intronic
904543912 1:31253498-31253520 AAAAAAAGTTGTCCTTGGCCAGG - Intergenic
904747965 1:32722736-32722758 AAAATTAGCTGGGCATGGCCGGG + Intergenic
905588253 1:39138958-39138980 AAAATTATTTGGCCTAGGCCAGG - Intronic
906170265 1:43719012-43719034 AAAATACTTTGTCACTGGCCAGG - Intronic
906262319 1:44403500-44403522 AAAATTATTTGGGCATGGAGGGG + Intergenic
909389139 1:75098101-75098123 AAAATAAGTTGCCAAGGGCCAGG + Intergenic
909577541 1:77191728-77191750 AAAATCTTTTGGCAATGGCCAGG + Intronic
909892686 1:81027788-81027810 AAAACAAGGTGGCCTTGGCCAGG + Intergenic
910049849 1:82960932-82960954 AGAATTATTTGGTGATGGCCTGG - Intergenic
910293460 1:85621024-85621046 GAAATATGTTGGCCTTGGCCTGG + Intergenic
910573028 1:88727465-88727487 AAAAAAATGTGGCCTTGGGCCGG - Intronic
911442821 1:97949962-97949984 AAAATTATTTGGCCTTGGTAGGG + Intergenic
912128123 1:106565848-106565870 AAAATAACTCTGCCAAGGCCAGG - Intergenic
913003308 1:114603421-114603443 AAAAAAAATTGGACTTGGCCAGG - Intronic
913260934 1:116997425-116997447 AAAATATTTTGGCAACAGCCAGG + Intergenic
914724712 1:150318069-150318091 AAAATCAGCTGACCATGGCCAGG + Intergenic
914773622 1:150715722-150715744 AAAATAATACAGCCAGGGCCAGG - Intronic
915031680 1:152885114-152885136 AAAATATTATGGGCATGTCCTGG + Intergenic
916074035 1:161190055-161190077 AAAATTAGTTGGGCGTGGCCAGG + Exonic
916751651 1:167728317-167728339 AAAAAAATTTGGGCAGGGCACGG - Intronic
917209196 1:172614388-172614410 AAAATAAGCTGGGCATGGCCAGG + Intergenic
918502916 1:185217993-185218015 AAGATAATTTTTCCATGGACGGG - Intronic
918701408 1:187613168-187613190 AAAATAATTTGTTTAAGGCCGGG + Intergenic
918779765 1:188684535-188684557 AAGATAATTTTTCCATGGACTGG + Intergenic
919346050 1:196379785-196379807 TAAGAAATTTGCCCATGGCCTGG - Intronic
919677619 1:200400465-200400487 AGAATAAATCTGCCATGGCCTGG + Intergenic
920008018 1:202847484-202847506 AAAATTAGCTGGCCATGGCTGGG - Intergenic
922299989 1:224290504-224290526 AAAATTAGCTGGGCATGGCCAGG + Intronic
923327144 1:232890172-232890194 AAAATTAGCTGGGCATGGCCGGG - Intergenic
923707057 1:236352550-236352572 AAAATAAATTAGCCAGGGCCAGG + Intronic
923907976 1:238407403-238407425 AAAAAAATTTGGACAAGGCCAGG + Intergenic
923999052 1:239530191-239530213 AAAATAATTTGGGCCGGGCACGG - Intronic
924366585 1:243300156-243300178 AAAATAATTAATTCATGGCCAGG - Intronic
1062861727 10:815607-815629 AAGTTAATTTGCCCAAGGCCAGG + Intronic
1064069953 10:12219981-12220003 AAAATTAGTTGGGCATGGCCGGG - Intronic
1064111521 10:12543342-12543364 TTAATAATTGGGCAATGGCCAGG - Intronic
1064184786 10:13152240-13152262 AAAATTAGCTGGACATGGCCAGG - Intergenic
1064422111 10:15199274-15199296 AGAATAAGTTAGCCTTGGCCGGG - Intergenic
1065657196 10:27963929-27963951 AAAATAATTTGGGCCGGGCATGG + Intronic
1067372861 10:45701078-45701100 AAAATTAGCTGGGCATGGCCGGG + Intergenic
1067374973 10:45719529-45719551 AAAATAATTTAGGCCTGTCCAGG + Intergenic
1067378757 10:45752992-45753014 AAAATAATTTAGGCCTGTCCAGG - Intronic
1067386919 10:45825041-45825063 AAAATTAGCTGGCCATGGCCGGG - Intergenic
1067419208 10:46132210-46132232 AAAATTAGCTGGGCATGGCCGGG + Intergenic
1067447354 10:46359569-46359591 AAAATTAGCTGGGCATGGCCGGG + Intergenic
1067504558 10:46838798-46838820 AAAATTAGCTGGGCATGGCCGGG + Intergenic
1067876342 10:50011038-50011060 AAAATTAGCTGGGCATGGCCGGG + Intergenic
1067882785 10:50061170-50061192 AAAATAATTTAGGCCTGTCCAGG + Intergenic
1067886456 10:50093672-50093694 AAAATAATTTAGGCCTGTCCAGG - Intronic
1067936611 10:50617866-50617888 AAAAAAATTAAGCCAGGGCCAGG - Intronic
1068988716 10:63130183-63130205 AAATTATTTTGGTCTTGGCCGGG + Intergenic
1069032221 10:63609462-63609484 AAAAAAAGTTGCCCTTGGCCGGG + Intronic
1070133740 10:73673722-73673744 AAAATTAGCTGGGCATGGCCGGG - Intergenic
1071594960 10:86914786-86914808 AAAATAGTTTGACAATTGCCTGG + Intronic
1071607972 10:87010755-87010777 AAAATTAGCTGGGCATGGCCGGG + Intergenic
1071744256 10:88398069-88398091 AAGATTATTTGGGCATGGCAAGG + Intronic
1072560691 10:96571033-96571055 AAAATCTTTTTCCCATGGCCGGG - Intronic
1073225166 10:101912097-101912119 AAAATGATTTGAGCATGGCTGGG + Intronic
1073252653 10:102130895-102130917 AAAATTAGCTGGGCATGGCCAGG + Intergenic
1073343739 10:102766144-102766166 AAAAAAAATTAGCCAGGGCCAGG + Intronic
1073786429 10:106895313-106895335 AAAATAAATTGGAGATGACCAGG + Intronic
1076353393 10:129834068-129834090 AAAATAATTTCTCCATCCCCGGG + Intergenic
1077513512 11:2986076-2986098 TATAAAATTGGGCCATGGCCAGG + Intronic
1077943791 11:6872968-6872990 AAAATTAGTTGGGCATGGCTTGG - Intergenic
1078262731 11:9725864-9725886 AAAATATTTTGGAAATGGCCTGG - Intronic
1078372860 11:10765186-10765208 AAAATAATTTAGGCCTGGCATGG + Intronic
1079962611 11:26942559-26942581 CAGATAATTTGGTCATGGTCTGG + Intergenic
1081402643 11:42661228-42661250 AAAGTCATGAGGCCATGGCCAGG + Intergenic
1084040178 11:66538100-66538122 AAAATTAGCTGGGCATGGCCAGG + Intronic
1084129541 11:67122616-67122638 ATAAAAAATAGGCCATGGCCAGG - Intronic
1084137983 11:67201473-67201495 ACAAAAAATTAGCCATGGCCCGG + Intronic
1084159786 11:67340907-67340929 AAAATAATTTGGCCATGGCCAGG - Intronic
1084305567 11:68280743-68280765 AAAATTACCTGGGCATGGCCGGG - Intergenic
1084578681 11:70008536-70008558 AAGATCATTTGACCATGTCCAGG + Intergenic
1085124464 11:73989827-73989849 AAAATAATGTGCTGATGGCCAGG - Intergenic
1085211748 11:74786952-74786974 AAAATATTTTAGCAATAGCCTGG - Intronic
1085701983 11:78753792-78753814 GTAATACTTTGGCCAGGGCCAGG - Intronic
1086181175 11:83953512-83953534 AAGATAATTTTTCCATGGACAGG - Intronic
1087454971 11:98373295-98373317 ATAAGAATTAGGACATGGCCGGG + Intergenic
1087711503 11:101558709-101558731 AAAATCATTTGACCATAGGCTGG - Intronic
1087827080 11:102777549-102777571 AAAATTATTTGATTATGGCCAGG - Intronic
1089204512 11:116748690-116748712 AAAATATTTTAGGCATGGCCGGG + Intronic
1091520844 12:1240197-1240219 AAAATAATTTGGAGATTGCTGGG + Intronic
1091724633 12:2837180-2837202 AAAATTAGCTGGGCATGGCCGGG + Intronic
1092338605 12:7656125-7656147 AAAAAAATTTGGCCTAGGCATGG - Intronic
1092452444 12:8615421-8615443 ATAATAATTTAGACAAGGCCAGG - Intergenic
1092645204 12:10563414-10563436 AAAAGAATTTGAGCCTGGCCTGG + Intergenic
1093268421 12:17027761-17027783 AAAAGAATTGGGCTAAGGCCAGG - Intergenic
1093346725 12:18046173-18046195 AAAGTAACTTGGAAATGGCCGGG + Intergenic
1093440681 12:19192400-19192422 AAAATAATTTACTCTTGGCCTGG + Intronic
1093615816 12:21222837-21222859 ATTGTAATTTGGCCATAGCCTGG - Intronic
1095308384 12:40664251-40664273 AAAGTAACATGGTCATGGCCAGG - Intergenic
1096198156 12:49662328-49662350 AAAATAATTGAGCCAGGGTCTGG - Intronic
1096307114 12:50487590-50487612 AAAAAAAATTAGCCAGGGCCTGG + Intergenic
1097639640 12:62164825-62164847 AAAATAATTAGTACAAGGCCTGG + Intronic
1098618021 12:72554141-72554163 AAAATTATATGGACTTGGCCGGG - Intronic
1099028093 12:77491250-77491272 AAAACAATTTTTCCATGGACTGG - Intergenic
1099120799 12:78686976-78686998 AAGATAATGGGGCCATGGCGGGG - Intergenic
1099258460 12:80345530-80345552 AAAATATTATAGCCATGGTCAGG - Intronic
1099970741 12:89497472-89497494 AAAGTAATTTGGCTATTACCTGG - Intronic
1100441822 12:94624415-94624437 AATATTATTCAGCCATGGCCAGG + Intronic
1100824405 12:98461550-98461572 AAAATACTCTGTACATGGCCGGG + Intergenic
1102110921 12:110365276-110365298 AAAATTATCTGGCCATGGTGGGG + Intergenic
1102430987 12:112882645-112882667 TTCATAATTTGGCCATGGCCAGG - Intronic
1103697997 12:122832589-122832611 AAAATTAGCTGGGCATGGCCAGG + Intergenic
1103777415 12:123376545-123376567 AAAATTATCAGGCCAGGGCCAGG - Intergenic
1104726353 12:131077902-131077924 ATAATAATCTAGCCATAGCCAGG - Intronic
1106238226 13:27884183-27884205 AAAATAACTGGGTCATGGGCTGG + Intergenic
1106733005 13:32561296-32561318 ACAAAAATTGGGCCATGTCCAGG - Intergenic
1106966780 13:35080555-35080577 AAAATATTTTTGCCATGGAGAGG + Intronic
1106994615 13:35467176-35467198 AAAATAATGAGTCTATGGCCAGG + Intronic
1109348306 13:61144634-61144656 AAAATAATTTAGCCATGTGCAGG + Intergenic
1110233306 13:73189769-73189791 AAAATAATTTGGATTTGGCGTGG + Intergenic
1110302627 13:73947353-73947375 AATATGAATTGGCAATGGCCGGG + Intronic
1110536197 13:76653610-76653632 AAGAAAATGTGTCCATGGCCGGG + Intergenic
1110583422 13:77159146-77159168 CAAATAATTTGTCCAAAGCCAGG - Intronic
1111113410 13:83745053-83745075 AAAATAATTTCCCCATGACATGG - Intergenic
1112263831 13:97903870-97903892 AAAAAAATTTGGTTGTGGCCAGG - Intergenic
1112424387 13:99284026-99284048 AAAATAAAGTGGCATTGGCCAGG - Intronic
1114384717 14:22242981-22243003 ATAATAATTTGGCCATCTCATGG - Intergenic
1114457776 14:22867918-22867940 AAAATAATAGGGCCGGGGCCGGG + Intergenic
1115547830 14:34479026-34479048 AAAATATTTTAGGCCTGGCCGGG + Intergenic
1115920995 14:38373256-38373278 AAAATTATTTGCCACTGGCCGGG + Intergenic
1117391316 14:55265622-55265644 AAAATAATATAGGCTTGGCCGGG + Intergenic
1118035218 14:61859152-61859174 AAAATGATTTGGGGCTGGCCGGG - Intergenic
1118755473 14:68840115-68840137 AATATTATTTAGCCTTGGCCAGG + Intergenic
1119275167 14:73348670-73348692 AAGATAATTTTTTCATGGCCTGG - Intronic
1119350859 14:73964243-73964265 AAAATACTTAGGACATGGCCTGG - Exonic
1119497206 14:75090126-75090148 AAAAAAATAAGGCCAGGGCCAGG - Intronic
1119653131 14:76397607-76397629 AAAATAATTTGGGGCAGGCCAGG + Intronic
1119989708 14:79182221-79182243 AAGATAATTTTTCCATGGACTGG + Intronic
1120367524 14:83589870-83589892 AAAATATTTTGGGCCTGGCGCGG + Intergenic
1120605885 14:86577689-86577711 AAAAAAAATTGGTCATGGCAGGG - Intergenic
1121069951 14:91009536-91009558 AAAATACCTTAGACATGGCCAGG - Intronic
1121197393 14:92086265-92086287 AAAAAAATTTAGCCGGGGCCAGG + Intronic
1121761469 14:96448658-96448680 AAAAAAATTACGGCATGGCCAGG + Intronic
1122180104 14:99948672-99948694 AAAATTAGCTGGGCATGGCCAGG + Intergenic
1122241432 14:100370696-100370718 AAAAAAACTTGCCCATGGCTGGG + Intronic
1122748578 14:103916011-103916033 AAAAGAATATGGCCAGGGCATGG + Intronic
1122992359 14:105242818-105242840 AAAAAAATTTGGCCGGGGCCAGG + Intronic
1124873603 15:33568371-33568393 AAAATAATTTTCCCATTGTCAGG - Intronic
1126487963 15:49203817-49203839 AAAATCATTTGGCCTTGGCCAGG + Intronic
1128442840 15:67729473-67729495 AAATGGATTTTGCCATGGCCAGG + Intronic
1128926586 15:71661689-71661711 AAAGTAATTTGTTCAAGGCCAGG - Intronic
1129027210 15:72588256-72588278 AAAAAAAACTGCCCATGGCCGGG - Exonic
1129353128 15:74969149-74969171 AAAATTAGTTGGGCATGGCCGGG - Intronic
1130775953 15:86983322-86983344 AAAATAGATTAGCCATGGTCTGG - Intronic
1131534825 15:93228008-93228030 AAAATTAGCTGGGCATGGCCGGG - Intergenic
1132019142 15:98345468-98345490 AAAATAATGTGAACATGGCCGGG + Intergenic
1132735982 16:1386255-1386277 AAAAAAAATTAGCCAAGGCCGGG + Intronic
1133442668 16:5833800-5833822 ATAATAATTTGGACAGGGCCTGG - Intergenic
1133765150 16:8832702-8832724 AAAGTAATCTGATCATGGCCCGG + Intronic
1134128183 16:11630555-11630577 AAAAAAAGTTGGCCAGGGGCAGG - Intronic
1134285917 16:12862166-12862188 AAGATAATTTTTCCATGGACCGG + Intergenic
1134645286 16:15860153-15860175 AAACTAAAGTGGCCAAGGCCAGG + Intergenic
1134859029 16:17544493-17544515 AATATTATTTGGCCATGAACAGG + Intergenic
1135742510 16:24988409-24988431 AAAATATTTTGGCAATGACGTGG + Intronic
1135754870 16:25088758-25088780 AAAATATTTTGGCAATGGTGTGG + Intergenic
1135853321 16:25984245-25984267 AAGACAATTTTTCCATGGCCAGG + Intronic
1137018099 16:35395463-35395485 AAAATTAGCTGGCCATAGCCAGG + Intergenic
1137020014 16:35415180-35415202 AAAATAATTTTGTCAGTGCCTGG - Intergenic
1138164872 16:54791973-54791995 AAAATAATTTCATCTTGGCCGGG + Intergenic
1138500298 16:57437819-57437841 AAAATAGTATCGCTATGGCCAGG - Intronic
1139166570 16:64572973-64572995 CAAATAATGTGGAAATGGCCGGG - Intergenic
1139710082 16:68769630-68769652 AAAATATTTTATCCATGGCTGGG + Intronic
1140216261 16:73011277-73011299 AAAAAAAATTAGCCAGGGCCAGG - Intronic
1140446329 16:75031421-75031443 ACAAAAATTTGGACATGGCCGGG - Intronic
1140784550 16:78327739-78327761 TAAATAATATAGCCATGGTCGGG - Intronic
1203140714 16_KI270728v1_random:1763809-1763831 AAAATAAATTATCCATGGCTGGG - Intergenic
1143009085 17:3855838-3855860 AGAATAGTTTTGCTATGGCCGGG - Intergenic
1146224873 17:31056890-31056912 GAAATAATTTAGCCTGGGCCTGG - Intergenic
1146689419 17:34862962-34862984 AAGATAATTTTTCCATGGACTGG - Intergenic
1147304778 17:39555696-39555718 AAAAGAATCATGCCATGGCCAGG + Intronic
1148416533 17:47510924-47510946 AAAATTATCTGGGCATGGTCGGG - Intergenic
1148690756 17:49525398-49525420 GAAAGAATGTGGCCTTGGCCGGG + Intergenic
1149592044 17:57837493-57837515 GAAATATTTTGGGCATGGACAGG - Exonic
1149829354 17:59857776-59857798 AAAATATTTAGGCATTGGCCAGG + Intergenic
1150324173 17:64242794-64242816 AAAACAATTTGGCCAGGTGCAGG + Intronic
1150492070 17:65581203-65581225 AAAAAAAATTAGCCAGGGCCAGG - Intronic
1150695020 17:67397274-67397296 AAAATAAGATGGTCACGGCCAGG - Intronic
1152093616 17:78259941-78259963 AAAAGAAATAGACCATGGCCAGG + Intergenic
1154980814 18:21500771-21500793 AAGATAATGTGCCCAAGGCCAGG + Intronic
1155471293 18:26195214-26195236 AAAAAAAATTAGCCTTGGCCGGG + Intergenic
1155475038 18:26228953-26228975 TAAATAATTTGTCCAATGCCAGG + Intronic
1155815806 18:30307866-30307888 AAAATAATAAGGACCTGGCCTGG - Intergenic
1156179071 18:34581915-34581937 AAAATAATAGGGGCAGGGCCGGG - Intronic
1156860373 18:41828970-41828992 ATAATAGTTTTGCCCTGGCCAGG - Intergenic
1158180107 18:54705037-54705059 AAAATTAGTTGGGCATGGCGGGG - Intergenic
1158841797 18:61395737-61395759 AAAATTATATGACCTTGGCCAGG + Intronic
1159376176 18:67596647-67596669 AAGATAGTTTGGCAGTGGCCAGG + Intergenic
1159504547 18:69318092-69318114 AAAAAAATTTGCCAATGCCCTGG + Intergenic
1159557148 18:69957472-69957494 AAACTAACGTTGCCATGGCCTGG - Intronic
1160961609 19:1724403-1724425 AAAGTAATGGGACCATGGCCAGG + Intergenic
1161150222 19:2703618-2703640 AAAAAAAATTAGCCAGGGCCAGG - Intergenic
1161272944 19:3400178-3400200 ATAAAAATTCGGCCCTGGCCAGG + Intronic
1161430930 19:4231929-4231951 AAAATTAGCTGGGCATGGCCAGG + Intronic
1161561578 19:4975952-4975974 AAAAAAAATGGGGCATGGCCGGG + Intronic
1161965636 19:7546557-7546579 AAAATTAGGTGGGCATGGCCAGG - Intronic
1162563471 19:11431637-11431659 AAAATTAGCTGGGCATGGCCGGG + Intronic
1162610567 19:11746970-11746992 AAAATATATCAGCCATGGCCAGG + Intergenic
1162755503 19:12856598-12856620 AAAAAAATGTGGCAAAGGCCAGG - Intronic
1163043244 19:14618559-14618581 AAAATAAGTTAGCCTGGGCCGGG + Intergenic
1163286286 19:16350284-16350306 AAAAAAAATTAGCCAGGGCCGGG + Intergenic
1163351484 19:16778828-16778850 AAATCACATTGGCCATGGCCGGG - Intronic
1163460214 19:17432831-17432853 AAAATTAGCTGGTCATGGCCAGG - Intronic
1163742010 19:19020726-19020748 AAAATATTTTGGGCAGGGCATGG - Intronic
1164449479 19:28348054-28348076 AAAATAATTTACCCTCGGCCAGG - Intergenic
1165357105 19:35311035-35311057 AAAAAAAATAGGCCTTGGCCGGG + Intronic
1166134409 19:40766903-40766925 AAAATAATATGCACATGGCCCGG + Intergenic
1166370750 19:42299411-42299433 AAAATTAGTTGGGCATGGGCTGG - Intronic
1166961819 19:46501593-46501615 AAAATTAGCTGGTCATGGCCAGG + Intronic
1167036276 19:46996860-46996882 AAAAGAGTGTGCCCATGGCCGGG + Intronic
1167151500 19:47712992-47713014 AAAATAATTTAGCCAGGCACAGG - Intergenic
1167345817 19:48945021-48945043 AAAAGAATTTGGGCAGGGCTGGG + Intergenic
1167551153 19:50161918-50161940 AAAAAAATTTGGCTCTTGCCTGG + Intronic
1167556294 19:50198023-50198045 AAAAAAAATTAGCCAGGGCCAGG + Intronic
1167617118 19:50541441-50541463 AAGATAATTTTTCCATGGACTGG - Intronic
1168437261 19:56329051-56329073 AAAATAATTTGACCTTGGCTGGG + Intronic
1168540235 19:57203889-57203911 AAAACTGTGTGGCCATGGCCAGG + Intronic
1168592537 19:57649382-57649404 AAAATTAGCTGGGCATGGCCGGG + Intergenic
925786013 2:7431726-7431748 AAAATCATCTGGCTGTGGCCAGG - Intergenic
926552874 2:14321098-14321120 TAAATGATTTGCCCAGGGCCAGG - Intergenic
928024297 2:27727529-27727551 ACAATGATCTGGCCATGGCATGG + Intergenic
928286998 2:30000220-30000242 AAAAAAATCTTCCCATGGCCAGG + Intergenic
928820017 2:35350453-35350475 AAAATACTTTGGCCAAGACAAGG + Intergenic
929055537 2:37873307-37873329 AATATAATTTGCACATGCCCTGG + Intergenic
930546862 2:52778990-52779012 AAAACAATTTGTACATGGTCTGG + Intergenic
932725217 2:74173971-74173993 AAAATGATGGGGCCATGGCTAGG + Intronic
932814159 2:74848742-74848764 TAAATAATTTGATCAAGGCCAGG + Intronic
933201948 2:79461135-79461157 AAAATTACTGGGCCATGGCCAGG - Intronic
933365240 2:81345389-81345411 ATAATAATTCGGCAATGGCTTGG + Intergenic
933393321 2:81700746-81700768 AAAATAAGTTGGAATTGGCCAGG + Intergenic
933606241 2:84387245-84387267 AAAATAATTTGTGTATGGCAAGG - Intergenic
935589079 2:104829164-104829186 AAAATAATTTAGTTGTGGCCGGG + Intergenic
936041108 2:109150191-109150213 AAGATGAGTTGGACATGGCCAGG + Intronic
936395108 2:112120665-112120687 AAAATAATAGTGCCTTGGCCAGG + Intergenic
937660773 2:124427750-124427772 AAAATAATATGGGTTTGGCCGGG - Intronic
937765444 2:125655719-125655741 AAAAAAATATAGCAATGGCCGGG + Intergenic
938751507 2:134335285-134335307 AAAATAATTTTTCTATGGCCAGG - Intronic
938861582 2:135375148-135375170 AAAAAAATATGGTCTTGGCCGGG + Intronic
942007288 2:171717408-171717430 AAAAGTACTTGGACATGGCCGGG - Intronic
942234816 2:173893578-173893600 AAAATTAGCTGGGCATGGCCGGG - Intergenic
944824752 2:203471006-203471028 AAAATAATTTGTAAATGGCATGG + Intronic
945082674 2:206101681-206101703 AAAAAAAGTTACCCATGGCCAGG - Intergenic
945157375 2:206853620-206853642 AAGATAATTTTTCCATGGACTGG - Intergenic
947758646 2:232587635-232587657 AGAATAATTTGGGCAGAGCCAGG - Intergenic
948510791 2:238463597-238463619 AAAATCAGTTGACCATGGCTGGG + Intergenic
948951873 2:241258101-241258123 AAAATAAGCTGGCCAAGGCCAGG + Intronic
949026690 2:241769719-241769741 AAAATTATCTGGGCATGGCCGGG - Intergenic
1169768723 20:9178026-9178048 AAAATAATTTTGGCCAGGCCAGG + Intronic
1170215744 20:13889279-13889301 AAAATAAATTAACAATGGCCAGG - Intronic
1170862201 20:20117058-20117080 AAAATAAATTGGCTGTAGCCAGG + Intronic
1172426030 20:34856737-34856759 AAAACGATGTGGCCATGGACTGG + Intronic
1172660571 20:36565381-36565403 AGAATAATGTGGCCCTGGCATGG - Intergenic
1172849978 20:37954650-37954672 AAAATAATTTTTCCGTGGACCGG + Intergenic
1173434360 20:43019323-43019345 AGAATAATTGGGCTGTGGCCGGG + Intronic
1174636231 20:52002053-52002075 ACCATAATGTGGCCATGGCCAGG - Intergenic
1176290488 21:5041729-5041751 AAAATAATTTGTCAATTGGCTGG + Intergenic
1177239805 21:18441984-18442006 AAAATAATGTGTCCTGGGCCGGG - Intronic
1177364077 21:20111414-20111436 AAGATAATTTTGCCATGGACAGG + Intergenic
1177422273 21:20875234-20875256 AAAATAAATTGATCAAGGCCAGG - Intergenic
1178065088 21:28895747-28895769 AAGACAATTTTTCCATGGCCAGG - Intergenic
1178341629 21:31790358-31790380 AAGATAATTTTTCCATGGACTGG + Intergenic
1178727737 21:35069682-35069704 AATATAAGTTGACCATGTCCAGG + Intronic
1179866767 21:44221912-44221934 AAAATAATTTGTCAATTGGCTGG - Intergenic
1182559176 22:31145965-31145987 AAAATCATACGTCCATGGCCAGG - Intergenic
1182725459 22:32441813-32441835 AAGATGATTTTTCCATGGCCTGG + Intronic
1183914341 22:41104867-41104889 AAAATTAGCTGGGCATGGCCGGG + Intronic
949361650 3:3238498-3238520 AAAACAATTTTTCCATGGACTGG - Intergenic
949441113 3:4081613-4081635 TAATTAATTTGACCATGGCCAGG + Intronic
949857367 3:8474077-8474099 AAAACACTTTGACCAGGGCCTGG + Intergenic
949901928 3:8822286-8822308 AAAATGATTTTGCAATAGCCTGG - Intronic
951512777 3:23522425-23522447 AAAATAAGCTGGTTATGGCCAGG - Intronic
951607578 3:24452852-24452874 AAAATAATTTAACCTTGTCCTGG - Intronic
951925318 3:27902757-27902779 AAAAATAGTGGGCCATGGCCGGG - Intergenic
952268803 3:31812325-31812347 ATAATAACCTGGCCAGGGCCAGG - Intronic
952673701 3:36000932-36000954 AGCATAATTTGGCCATGATCTGG + Intergenic
954009956 3:47627375-47627397 AAAAGAATTTTTCCATGGCCTGG - Intronic
954544694 3:51423196-51423218 GAAATAATCAGGCCAGGGCCAGG + Intronic
954955472 3:54514750-54514772 GAAATAATTTAGCCAGGGGCTGG + Intronic
955066011 3:55534266-55534288 AAAATAAATTAGCCTTAGCCAGG + Intronic
955845822 3:63161701-63161723 TAGATAATTTGGCCATTTCCAGG - Intergenic
956362233 3:68460984-68461006 CAAATAACCTGGCCATGGCCAGG + Intronic
957525363 3:81372477-81372499 GAAATAATTTGGGCATGGTGTGG - Intergenic
958101854 3:89021554-89021576 AAACTAATTTAGCCCTGGCATGG - Intergenic
958850049 3:99314027-99314049 AAACTAATTTGGCCATAGGGAGG + Intergenic
959804038 3:110529638-110529660 AAAATAATTTGGCCATGTGCAGG + Intergenic
960150792 3:114246763-114246785 AAAATAAATTACCCATGGCCAGG + Intergenic
960614337 3:119582990-119583012 AAGATAATTTTTCCATGGACGGG - Intronic
961758078 3:129142757-129142779 AAAATTAGCTGGGCATGGCCAGG + Intronic
962626961 3:137235445-137235467 AAAATAATATTTCAATGGCCAGG - Intergenic
963646205 3:147918063-147918085 AAAATAATGTGGTACTGGCCGGG + Intergenic
964138170 3:153368755-153368777 AAAAAATTTTGGCTATGACCTGG + Intergenic
965150970 3:164974430-164974452 AAAATAATTTGGCAGTGCCAGGG - Intergenic
965450535 3:168832894-168832916 AAGATAATTTTTCCATGGTCTGG - Intergenic
965956205 3:174373008-174373030 AAAATAAGTTGGCTATGGCCGGG - Intergenic
966209232 3:177435381-177435403 AAAATAATAAGCACATGGCCAGG - Intergenic
966607033 3:181831744-181831766 AAAATTATCTGGGCATGGCAGGG - Intergenic
967011864 3:185442821-185442843 ATAATAATTTGGCCAGGCCGCGG - Intronic
967058587 3:185851520-185851542 AAAATTAGCTGGGCATGGCCAGG + Intergenic
967806558 3:193719416-193719438 AAAATCATTTGGCCATAGTGTGG + Intergenic
967995979 3:195166970-195166992 TAGATAATTGGCCCATGGCCGGG - Intronic
969406143 4:6993460-6993482 TAAATAGTTTTGCCATGCCCTGG - Intronic
971216719 4:24668865-24668887 AAAATGAACTGGCCAGGGCCGGG - Intergenic
972132528 4:35856185-35856207 AAAATAATTTGGTTATGACTAGG + Intergenic
972186400 4:36533423-36533445 AAAAGAAAGTGGCCATGGGCTGG - Intergenic
972419932 4:38877667-38877689 AAAAAAAGTTTGCCCTGGCCGGG + Intronic
972500605 4:39674574-39674596 GAAATAATTTAGTCCTGGCCAGG - Intergenic
972566992 4:40278514-40278536 AAAATTAGCTGGACATGGCCAGG - Intergenic
973272088 4:48271614-48271636 AAGATAATTTTTCCATGGACAGG + Intergenic
974743721 4:66042326-66042348 ACAAAAAATGGGCCATGGCCGGG + Intergenic
974909774 4:68103143-68103165 AAAATTAGTTGACCACGGCCAGG + Intronic
975136363 4:70878530-70878552 AAAATTAGCTGGTCATGGCCAGG + Intergenic
975468833 4:74740649-74740671 AAAATAACTTGGGCAGGGACTGG - Intergenic
976238052 4:82921730-82921752 AAAATAAATAAGACATGGCCAGG + Intronic
976507099 4:85860685-85860707 AAAATAATTTGTCCATCACCAGG + Intronic
978557648 4:109997923-109997945 AAAATTATTTGGCTATGGAAAGG + Intronic
978810314 4:112842298-112842320 AAAATAATTTGGGCCGGGCGTGG - Intronic
981774977 4:148355876-148355898 TAAGTAATTTGGCCAGGGTCAGG - Intronic
983010483 4:162539537-162539559 AAAATACTCTTGCAATGGCCAGG - Intergenic
986464739 5:8010048-8010070 GAAATGATTTGGCCATGGGTAGG + Intergenic
987490197 5:18570402-18570424 AAAATAAGTTGGCGATAGACAGG - Intergenic
988476694 5:31592334-31592356 AAATTCCTTTGGCCAAGGCCGGG - Intergenic
988703652 5:33701645-33701667 AAGATACCTTTGCCATGGCCTGG - Intronic
989274569 5:39571884-39571906 AAAAAAAGTTGGCCAAGGACAGG - Intergenic
989410652 5:41116671-41116693 TAAAGACTTTGGCCATGGCAAGG + Intergenic
989822669 5:45813344-45813366 AAAATAATTTGGGAGTGGGCTGG + Intergenic
990688540 5:58335752-58335774 CAAATAAATTGTGCATGGCCAGG + Intergenic
990937329 5:61164279-61164301 AAAACAATTTTTCCATGGACGGG - Intergenic
992784591 5:80157286-80157308 AAAAATATTTGCCCTTGGCCAGG - Intronic
993167232 5:84373057-84373079 AAAATGTTCTGGACATGGCCTGG - Intronic
993273386 5:85824166-85824188 ATGAAAATTTGGCCGTGGCCTGG + Intergenic
993744507 5:91580281-91580303 AAAATTATTTGGCAATGTGCAGG - Intergenic
994002123 5:94792579-94792601 AAAAGAGTATGGCCATGGTCTGG + Intronic
994169747 5:96645433-96645455 AAAATTATTTGGGCATGCACTGG - Intronic
994529334 5:100947851-100947873 AAAATAAGCTGGCCATGGCAAGG - Intergenic
994839055 5:104897798-104897820 AAAAATATTTGGGCTTGGCCGGG + Intergenic
997162574 5:131624825-131624847 AAATTAATCTGGCAATGGCTGGG + Intronic
997195894 5:131979624-131979646 GAAATAATTTGGGCATGTCTGGG - Intronic
997229211 5:132230489-132230511 AAAATTAGCTGGGCATGGCCAGG + Intronic
997699737 5:135888673-135888695 AAAATAATTTTGCCATTTCAGGG + Intergenic
997914790 5:137913477-137913499 AAAAAAAATTAGCCATGGCTGGG - Intronic
1001218660 5:169879792-169879814 AAAATGATTTGCCCAAGGCGAGG + Intronic
1001602537 5:172938455-172938477 ACAATCATTTGGCAATGGCCGGG + Intronic
1002096356 5:176833547-176833569 ACAATCTTTAGGCCATGGCCTGG + Intronic
1002142575 5:177152153-177152175 AAAATTAGCTGGGCATGGCCAGG - Intronic
1003944331 6:11059661-11059683 AAAATTACTTGCCCATGGGCCGG + Intergenic
1005057509 6:21743855-21743877 AAAATATTTGGCCCCTGGCCAGG - Intergenic
1006194493 6:32230133-32230155 AAACTAATGTGGGCATGGCTGGG + Intergenic
1006872859 6:37269104-37269126 AAAATAATTTAGCCATATCTAGG - Intronic
1007214227 6:40224014-40224036 AGAATATTTTGGTCATAGCCTGG + Intergenic
1007411669 6:41666363-41666385 AAAATAAATTGATCAAGGCCGGG - Intergenic
1007493366 6:42241755-42241777 TAAAAAATTTGGACTTGGCCAGG - Intronic
1007990361 6:46248919-46248941 AAAATCCATTGGCCATGGCATGG + Intronic
1008316462 6:50047848-50047870 AAAATAGTTTTGCCTTGGCCAGG + Intronic
1008420656 6:51295470-51295492 AACATAATTTGGCCAAGGAAAGG + Intergenic
1008793634 6:55272323-55272345 AAAATAATTTGTCCTTGGCACGG + Intronic
1009003559 6:57751359-57751381 AAAATAATGTGGGCCTGGCGCGG + Intergenic
1010260449 6:73809361-73809383 AAAATATTTTGGGGATGGCCTGG + Intronic
1011274980 6:85622074-85622096 AAAAAAATGTGTCCAGGGCCAGG + Intronic
1011400098 6:86951916-86951938 AAAATATATTTGCCAAGGCCTGG - Intronic
1011539445 6:88414901-88414923 ATAATAATTTGGCCATCTCATGG + Intergenic
1011581736 6:88875510-88875532 AAAATAATGAGGACATGACCTGG + Intronic
1011673280 6:89704873-89704895 AAAATTCATTGGCCACGGCCAGG - Intronic
1011960670 6:93085455-93085477 AAAATAGTTTGTCAATAGCCGGG + Intergenic
1012648673 6:101723168-101723190 CAAGTAATTTCTCCATGGCCAGG + Intronic
1014088703 6:117377399-117377421 AAAATAATTTGGGCCGGGCGTGG - Intronic
1014296155 6:119620490-119620512 AAAATGAGGTGGTCATGGCCGGG + Intergenic
1015438686 6:133221706-133221728 AAAATAAATTTGCCAGGGACAGG - Intergenic
1016071669 6:139746872-139746894 AAAATATTTAGCCTATGGCCTGG - Intergenic
1017317594 6:153049921-153049943 ATAATAATTAGGCAATGGCATGG + Intronic
1017907111 6:158764460-158764482 AAGACAATTTAGCCATGGTCGGG - Intronic
1018571796 6:165219394-165219416 AAAAGAATTTGGCCATTGCATGG - Intergenic
1019671587 7:2282824-2282846 AAAATTAGCTGGGCATGGCCAGG + Intronic
1020199227 7:6066224-6066246 TAAATAACTTGTCCAAGGCCAGG + Intergenic
1020872808 7:13654060-13654082 AATATTATTTGGCCATGGAAAGG + Intergenic
1021212786 7:17876283-17876305 TTAAAAACTTGGCCATGGCCAGG + Intronic
1021398397 7:20180147-20180169 AAAATATATAGGCAATGGCCAGG + Intronic
1022653124 7:32295042-32295064 AAAATAATTTGCCCTGGGACAGG + Intronic
1022971890 7:35526034-35526056 AAAATAATTTGCCCGTGTTCTGG - Intergenic
1024127208 7:46311724-46311746 AAGACAATTTTTCCATGGCCTGG + Intergenic
1024312916 7:47986125-47986147 AAAATAATTTGGGCTGGGCACGG - Intergenic
1026355712 7:69555381-69555403 AACAATATTTGGCCATGGCCAGG - Intergenic
1026648371 7:72192890-72192912 AAAAAAATTTTGCCAGGGCCAGG + Intronic
1026915763 7:74119472-74119494 AAAATAATCGGTACATGGCCGGG - Intronic
1027115254 7:75473981-75474003 AAAATACCTTGGACTTGGCCGGG - Intronic
1027361239 7:77412890-77412912 AAAACAATTTGGCACTGCCCAGG + Intronic
1027403435 7:77832888-77832910 AAGACAATTTTTCCATGGCCAGG - Intronic
1027529865 7:79316884-79316906 TAAATAACTTGCCCAGGGCCAGG + Intronic
1028879447 7:95863605-95863627 AAAATAATTTTGACATGTCAAGG - Intronic
1029490975 7:100869782-100869804 AAAACAATTTTTCCATGGACTGG + Intronic
1029541257 7:101183518-101183540 AAAATTAGCTGGGCATGGCCGGG - Intergenic
1029713033 7:102310018-102310040 ATAAAAATTTGGCCGGGGCCAGG + Intronic
1030603404 7:111613793-111613815 AAAATAAATTGCCCATAGCTGGG - Intergenic
1033214940 7:139486581-139486603 AAAAAAGGTTGGTCATGGCCCGG - Intergenic
1034999453 7:155601086-155601108 AAAATAATTTAGCCCGGGCGCGG - Intergenic
1035813019 8:2508145-2508167 AAGATAATTTTTCCATGGACAGG - Intergenic
1037934154 8:22903414-22903436 AAAATAATTGGGCAAAGGCAGGG + Intronic
1038338408 8:26663545-26663567 CACAGAATTTAGCCATGGCCAGG - Intergenic
1038496279 8:28005657-28005679 AGAATAATCTGGCCATGGCCAGG + Intergenic
1038612908 8:29070930-29070952 AAATGAATGTGGCCAGGGCCTGG + Intronic
1038964852 8:32560848-32560870 AAATTACTATGGCCATTGCCTGG + Intronic
1039248014 8:35631015-35631037 AAAATCATTTGGCCTGGGCCGGG + Intronic
1042180740 8:66085142-66085164 AAAATCAATTGGCCAGGGCCGGG + Intronic
1042493510 8:69429665-69429687 AAAATTAAATGGACATGGCCAGG - Intergenic
1042809311 8:72806373-72806395 AGAATAATTTGGCCAGGATCAGG + Intronic
1043176471 8:77028339-77028361 AAAATAACTTGACCAGGGCCGGG + Intergenic
1043738895 8:83782655-83782677 AAAATAAATTTGCAATTGCCTGG - Intergenic
1046184773 8:110698273-110698295 AAAATAATATGCTCATGGCTGGG + Intergenic
1046526668 8:115389669-115389691 AAGATAATTTTTCCATGGACTGG + Intergenic
1046647827 8:116805167-116805189 AAAATAATTAGTCCAGGGCCTGG + Intronic
1047633045 8:126729126-126729148 AAAGTAATTTGGCCAAGATCAGG + Intergenic
1048641345 8:136366111-136366133 AAAAAAATCTGGTCATTGCCAGG + Intergenic
1050332414 9:4558617-4558639 TTAATGATTTGGCCATGGGCTGG - Intronic
1051682018 9:19617093-19617115 AAGACAATTTTTCCATGGCCAGG + Intronic
1051734076 9:20180037-20180059 TAAAGATTTTGGCCATTGCCTGG + Intergenic
1052213303 9:25933491-25933513 TAATAAATTTGGCCATGACCTGG + Intergenic
1052662635 9:31455197-31455219 TAAATAATTTGCCCATGTTCTGG + Intergenic
1053154628 9:35768355-35768377 AAAATAACCTGTCCACGGCCAGG - Intergenic
1053856096 9:42341284-42341306 AAAATTATTGGCCCAGGGCCAGG + Intergenic
1055022645 9:71686537-71686559 AAGATAATTTTTCCATGGACTGG - Intronic
1055022719 9:71687319-71687341 AAGATAATTTTTCCATGGACTGG - Intronic
1055109786 9:72548419-72548441 AAAATTAATTGGGCATGGTCAGG + Intronic
1055362329 9:75506170-75506192 AAAATAAAATGGTGATGGCCAGG - Intergenic
1055418554 9:76110811-76110833 GAAATAACTTTGCTATGGCCAGG + Intronic
1056275050 9:84986292-84986314 AAAACAATTTTTCCATGGACAGG + Intronic
1056748661 9:89328088-89328110 AGAAAAATTTGGCCAGGGCAAGG - Intronic
1059196677 9:112377077-112377099 TAAATTAGTTGGCCATGGCCAGG - Intergenic
1059202093 9:112427348-112427370 AAAATAATGTGGCGAGGGCCAGG - Intronic
1059359920 9:113734235-113734257 AAGATAATTTTTCCATGGACAGG - Intergenic
1059901356 9:118929918-118929940 AAAATAATGTTGGCATGGTCTGG + Intergenic
1061145844 9:128797955-128797977 ACAAAAATTTGGCCCTGGCCAGG + Intronic
1062189531 9:135240758-135240780 AAAATCCTTTGGCCATGCCTCGG + Intergenic
1062248459 9:135582395-135582417 AAGACAATTTTCCCATGGCCCGG + Intergenic
1186243788 X:7598543-7598565 AAAAAAATCTGGTCATGCCCAGG - Intergenic
1186868025 X:13740841-13740863 AAAGTAGTTTTTCCATGGCCGGG + Intronic
1187153652 X:16704231-16704253 TAAATAACTTGCCCAAGGCCGGG - Intronic
1187199719 X:17123368-17123390 CAAATATTTTGACCATGACCTGG - Intronic
1187701164 X:21965486-21965508 AAAATTAGTTGGACATGGGCCGG + Intronic
1187790495 X:22945083-22945105 AATATAAGTTGGCCATGGATAGG - Intergenic
1187977519 X:24718321-24718343 AAATTAGTTGGGCGATGGCCAGG + Intronic
1188080967 X:25840051-25840073 AAAATAATTGGGCAAAGGACAGG + Intergenic
1188298866 X:28483424-28483446 AAAAAAAATTAGCCAGGGCCGGG + Intergenic
1189111589 X:38296016-38296038 AAAATTATTTGCCATTGGCCGGG + Intronic
1189213285 X:39302602-39302624 AAAACAATTTTTCCATGGACAGG - Intergenic
1189465008 X:41271886-41271908 AAAATTAGCTGGGCATGGCCAGG + Intergenic
1189797606 X:44660447-44660469 AATATAATTTTACCAGGGCCGGG - Intergenic
1190028386 X:46947595-46947617 AAATTAATTTGGGAATGGCATGG - Intronic
1190037651 X:47040662-47040684 AAGATAATTTTTCCATGGACTGG - Intronic
1190058420 X:47195544-47195566 AAAACAAGAGGGCCATGGCCAGG - Intronic
1190082225 X:47365605-47365627 AACATTAGTTGCCCATGGCCGGG + Intergenic
1190837047 X:54110762-54110784 AAAATTAGCTGGGCATGGCCGGG + Intronic
1191169549 X:57429038-57429060 CAAATAATTCTGCCAAGGCCAGG + Intronic
1192567415 X:72176796-72176818 AAAATTATTTGGCCACGGACTGG + Intergenic
1194673225 X:96761560-96761582 AAAATATTTTGGCCATGTCTGGG - Intronic
1194681273 X:96856739-96856761 AAAAAAATGTGGTCTTGGCCGGG + Intronic
1195088330 X:101434539-101434561 AGAATACTCTGACCATGGCCGGG - Intronic
1196998893 X:121416160-121416182 CAAATATTCTGTCCATGGCCTGG - Intergenic
1197249061 X:124195706-124195728 AAAATAATTTAGAAATGGACAGG - Intronic
1197504295 X:127282442-127282464 AAAATAATTCAGCAATGGCTGGG + Intergenic
1198494052 X:137172884-137172906 AATAGGATTTGGTCATGGCCAGG - Intergenic
1198551877 X:137753481-137753503 AAAATAACTGGGCTAAGGCCAGG - Intergenic
1198875023 X:141215484-141215506 AAAATAATTTCATCCTGGCCTGG + Intergenic
1199283979 X:146035988-146036010 AAGATAATTTTTCCATGGACTGG - Intergenic
1201073432 Y:10170005-10170027 AAAACAATTTTTCCATGGCAAGG + Intergenic
1202246552 Y:22826150-22826172 AATAAAATTTGGACAGGGCCCGG - Intergenic
1202399540 Y:24459898-24459920 AATAAAATTTGGACAGGGCCCGG - Intergenic
1202471240 Y:25210188-25210210 AATAAAATTTGGACAGGGCCCGG + Intergenic