ID: 1084159787

View in Genome Browser
Species Human (GRCh38)
Location 11:67340912-67340934
Sequence CATCAAAAATAATTTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 349}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084159787_1084159794 24 Left 1084159787 11:67340912-67340934 CCATGGCCAAATTATTTTTGATG 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1084159794 11:67340959-67340981 TAAAAGGTCTTTGAGCAAATGGG 0: 1
1: 0
2: 2
3: 26
4: 239
1084159787_1084159792 8 Left 1084159787 11:67340912-67340934 CCATGGCCAAATTATTTTTGATG 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1084159792 11:67340943-67340965 AACGTAATTAAGTGGGTAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 163
1084159787_1084159793 23 Left 1084159787 11:67340912-67340934 CCATGGCCAAATTATTTTTGATG 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1084159793 11:67340958-67340980 GTAAAAGGTCTTTGAGCAAATGG 0: 1
1: 0
2: 0
3: 23
4: 201
1084159787_1084159790 1 Left 1084159787 11:67340912-67340934 CCATGGCCAAATTATTTTTGATG 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1084159787_1084159789 0 Left 1084159787 11:67340912-67340934 CCATGGCCAAATTATTTTTGATG 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1084159789 11:67340935-67340957 ACAGTGCCAACGTAATTAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 87
1084159787_1084159795 25 Left 1084159787 11:67340912-67340934 CCATGGCCAAATTATTTTTGATG 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1084159795 11:67340960-67340982 AAAAGGTCTTTGAGCAAATGGGG 0: 1
1: 0
2: 0
3: 28
4: 287
1084159787_1084159796 29 Left 1084159787 11:67340912-67340934 CCATGGCCAAATTATTTTTGATG 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1084159796 11:67340964-67340986 GGTCTTTGAGCAAATGGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084159787 Original CRISPR CATCAAAAATAATTTGGCCA TGG (reversed) Intronic
900898505 1:5501224-5501246 CCCCAAAAATAACTGGGCCAGGG + Intergenic
903111734 1:21140608-21140630 CTGCATAAATAATTTTGCCAAGG - Intronic
905348896 1:37330879-37330901 CACCAACAAAAATTCGGCCAGGG + Intergenic
906883777 1:49622241-49622263 CATCAAAAAGACCTTGGCTATGG + Intronic
907404245 1:54244083-54244105 CATCGAAAATTAGTTGGGCATGG - Intronic
907631322 1:56085191-56085213 AAACAAAAATAATTAGGCCTGGG + Intergenic
907734214 1:57095927-57095949 CATCAAAATAAATATGGCAATGG + Intronic
908386648 1:63648784-63648806 CTTTAAAAATAATCTGGTCAGGG + Intronic
909649846 1:77962016-77962038 CACCAAAAATAATTTTTCCTAGG + Intronic
910327998 1:86032125-86032147 CATCCAAAAGCATTTAGCCAAGG - Intronic
910458305 1:87421780-87421802 CACCAAAAATAATTTTGACAGGG - Intergenic
910879504 1:91910127-91910149 AATAAAAAATTATTTGGGCATGG + Intergenic
911090554 1:94013779-94013801 CATCAAGATTAACTTGCCCAAGG + Intronic
912325234 1:108751872-108751894 CATCAGATATAATTTAGCAATGG + Intronic
912325626 1:108757911-108757933 CATTAAAAATAATTTTTCTAGGG + Intronic
912887034 1:113485481-113485503 CATCAAAAAAAAGTGGGCTAAGG - Intronic
913290041 1:117263506-117263528 CAGAAGAAAGAATTTGGCCAAGG - Intergenic
913329436 1:117654950-117654972 CATGTAAAGTAATTTGCCCAAGG + Intergenic
914396954 1:147278797-147278819 CATCTTAAGTAATTTGCCCAAGG + Intronic
914822119 1:151112679-151112701 CACCCACAAAAATTTGGCCAGGG - Intronic
915409055 1:155686748-155686770 AATCCAAAATAATATAGCCATGG + Intronic
915808860 1:158885416-158885438 CATCAAAAATAAGTTTAACAAGG + Intergenic
916838777 1:168578162-168578184 CACTAAAAATAAATTGGCAAAGG + Intronic
917030478 1:170684885-170684907 TTTTAAAAATAATTTGGCAAAGG + Intronic
917739978 1:177952656-177952678 CATCAAAAATCAATGGCCCAAGG + Intronic
918253888 1:182730413-182730435 CAAAAAAAAAAATTTGGCCGGGG + Intergenic
918934858 1:190909333-190909355 TGCCAAAAATAATTTGACCATGG + Intergenic
922047347 1:221959016-221959038 AATTAAAAATTATTTGGGCATGG - Intergenic
922351610 1:224738782-224738804 CATTAAAAATAAGAGGGCCAGGG + Intronic
923241819 1:232092812-232092834 TATCAAAAATAATTTAGGCCGGG + Intergenic
923999053 1:239530196-239530218 CAAAAAAAATAATTTGGGCCGGG - Intronic
924083261 1:240421204-240421226 CAGGAAAAAAAAGTTGGCCAAGG - Intronic
924869345 1:248024489-248024511 CATTAAAAATCATTTGGCCTAGG + Intronic
1062986509 10:1773922-1773944 CAAAAGAAAGAATTTGGCCAAGG - Intergenic
1064655292 10:17550333-17550355 AAGCTTAAATAATTTGGCCAAGG + Intergenic
1064813245 10:19225971-19225993 CATCAGTAATAATCTGACCAGGG - Intronic
1065565641 10:27005865-27005887 TATTAAATATAATTTGCCCATGG + Intronic
1066590782 10:36992063-36992085 CAACAAAAATAATTCATCCAAGG - Intergenic
1066785462 10:38999032-38999054 CCTTAAAACTAATTTGTCCAAGG - Intergenic
1068862027 10:61856943-61856965 CAGGACAAATAATTTGGCAAGGG - Intergenic
1069031341 10:63598934-63598956 AATTAAAAATTATTTGGTCATGG + Intronic
1069628395 10:69882078-69882100 CATCAGGACCAATTTGGCCAGGG - Intronic
1070440940 10:76442535-76442557 CATAAAAAATTATCTGGGCATGG + Intronic
1070488501 10:76953679-76953701 CATCAAAAATAATTAGGACCAGG + Intronic
1070979275 10:80631402-80631424 CATAAAAAATTAGTTGGGCATGG - Intronic
1071613418 10:87052512-87052534 AATCAAAAATTAGTTGGGCATGG + Intronic
1071978544 10:90979349-90979371 GATCAAAAATAAACTGGACATGG + Intergenic
1072922785 10:99590642-99590664 CTTCAAAGATAATCTTGCCATGG - Intergenic
1073126079 10:101150515-101150537 CTTGAAAAATACTTTGGTCAAGG - Intergenic
1073175729 10:101556043-101556065 CACCAGAAAGAATTTTGCCAAGG - Exonic
1074410857 10:113227309-113227331 CATCAAGAAGAATTTGGCAAGGG + Intergenic
1075205506 10:120444455-120444477 CATCAAAGACAATTTTTCCATGG - Intergenic
1075846239 10:125546977-125546999 CTACGAAAATATTTTGGCCATGG - Intergenic
1076320178 10:129573776-129573798 CACCAAAAAAAATATGGTCAAGG - Intronic
1079740435 11:24052454-24052476 CATCAAAAATATTTTGGACTGGG - Intergenic
1080006458 11:27413126-27413148 CACCTAAAATAAGTGGGCCAGGG + Intronic
1081930939 11:46870779-46870801 CACAAAAAATAATTTGGGCCAGG - Intronic
1082666184 11:55979042-55979064 CAACAAAAATAATGTGACCAAGG + Intergenic
1083761364 11:64820099-64820121 CATAAAAAAAAAATTAGCCAGGG - Intergenic
1084159787 11:67340912-67340934 CATCAAAAATAATTTGGCCATGG - Intronic
1084791730 11:71479233-71479255 AATCAAAAATTAGTTGGGCATGG - Intronic
1085425805 11:76403623-76403645 AATAAAAAATTATTTGGGCATGG - Intronic
1085428974 11:76430250-76430272 TATCAAAAATTATCTGGGCATGG - Intergenic
1085944272 11:81247651-81247673 CCTTAAGGATAATTTGGCCATGG - Intergenic
1086304998 11:85470314-85470336 CATCCAAAATGATTTTGCTATGG - Intronic
1086444172 11:86856968-86856990 CAACAAAAATAATGTGACAAAGG + Intronic
1086643192 11:89185916-89185938 CAAGAAAAATAATTTGGTGAAGG + Intronic
1089205427 11:116757784-116757806 CATCAAGAAGAATAAGGCCAAGG - Exonic
1091418024 12:307547-307569 CAACACAGATAGTTTGGCCAGGG + Exonic
1092357159 12:7805625-7805647 CCTGCAAAATAATTTGCCCAAGG - Intergenic
1092452445 12:8615426-8615448 CAGCAATAATAATTTAGACAAGG - Intergenic
1093105360 12:15079793-15079815 CATCAAAAATCATATTGACATGG - Intergenic
1094058258 12:26287649-26287671 CATAAAGAGAAATTTGGCCATGG - Intronic
1094261553 12:28506304-28506326 AATGAAAAATAAACTGGCCAGGG + Intronic
1095277437 12:40303865-40303887 CATCACAAATAATTTTCCCCAGG - Intronic
1095775548 12:46005773-46005795 CACCAACAATAATGTTGCCATGG + Intergenic
1096041702 12:48522624-48522646 TCTCAAAAATAAATTGGCAAGGG + Intronic
1097507700 12:60497062-60497084 CATCAAAAAAAAGTGGGCAAAGG + Intergenic
1097532905 12:60828035-60828057 CTTAAAAAATTATGTGGCCATGG - Intergenic
1097772692 12:63607212-63607234 CATCAAAAAAAATTCTGCCAAGG - Intronic
1100219094 12:92484591-92484613 CACAAAAAATAAATTGGACATGG - Intergenic
1100221482 12:92508713-92508735 CAACAAAAATTATCTGGGCATGG + Intergenic
1101212565 12:102549243-102549265 TAGCAAAAATCATTTGCCCAAGG + Intergenic
1101498923 12:105283010-105283032 TGTCAAAAATTATTTGGCCATGG - Intronic
1101939204 12:109087152-109087174 CATCAAAATTCCTTTGGCCCTGG - Exonic
1102718940 12:114999797-114999819 AATCCAAAATGACTTGGCCAGGG - Intergenic
1104389285 12:128377949-128377971 CAGCACAAATAACTTGTCCATGG - Intronic
1106038543 13:26067922-26067944 TATCAAAAATAACTTGGGCCAGG + Intergenic
1106355555 13:28979249-28979271 AATCAATAACAATTTGGCCATGG - Intronic
1106889639 13:34230825-34230847 CATATAAAATTATTTGGACATGG - Intergenic
1109386678 13:61638139-61638161 AAGCAGAAATAATTTGGCAAAGG + Intergenic
1110085895 13:71379332-71379354 AATCAGAAAGCATTTGGCCACGG - Intergenic
1110161183 13:72380246-72380268 CATATAACTTAATTTGGCCAAGG + Intergenic
1110724725 13:78807360-78807382 CTTCAGAATAAATTTGGCCAAGG - Intergenic
1110834678 13:80070149-80070171 CATTAAAAATACTTTTGCCAGGG + Intergenic
1111225168 13:85261262-85261284 TTTGAAAAATAATTTTGCCATGG + Intergenic
1114185860 14:20401692-20401714 CTTCAAAATAGATTTGGCCAAGG + Intronic
1115232666 14:31178205-31178227 CATCAAGAAAAATTTTGCAAAGG + Exonic
1115716491 14:36110752-36110774 CATAAAAAATAATATGGAAAAGG - Intergenic
1115895085 14:38077388-38077410 CATGAAATATCATTTGGCTAAGG + Intergenic
1116464620 14:45216921-45216943 CATCACTAATATTTAGGCCAAGG - Intronic
1116745869 14:48817818-48817840 ATACAAAAATAAATTGGCCATGG - Intergenic
1117039656 14:51758034-51758056 CCACAAAAATAATGTGACCAAGG - Intergenic
1118140724 14:63079260-63079282 CATCAAAAATCATTTTCCAATGG - Intronic
1119357396 14:74018827-74018849 TATCAAAAAACATTTGGCCTGGG + Intronic
1119994029 14:79232096-79232118 AAACATAAATAATTTGGCCCAGG + Intronic
1120002955 14:79324134-79324156 GCCCAGAAATAATTTGGCCAGGG + Intronic
1120661903 14:87259967-87259989 CATGTAAAACAATTTGGGCAAGG + Intergenic
1121298746 14:92852411-92852433 CATCTAAAATAATTCAGACAGGG - Intergenic
1122802649 14:104239387-104239409 CATCCAAAATAAGTTAGGCATGG - Intergenic
1124934122 15:34153854-34153876 CATAAAAATTATTTTGGCCATGG - Intronic
1125653123 15:41333543-41333565 CATCAATAAAAATTTACCCAAGG - Intronic
1126302140 15:47209325-47209347 CTTCCAAAATATTTTGGTCATGG + Intronic
1127514091 15:59674953-59674975 ATTAAAAAATAATTTGGCCTGGG + Intronic
1128926587 15:71661694-71661716 CATAAAAAGTAATTTGTTCAAGG - Intronic
1129782728 15:78284483-78284505 CATAAAAAATAAAATGTCCATGG - Intronic
1130129035 15:81121127-81121149 CATCAAAAATAATTTATAGAAGG - Intronic
1130670104 15:85904414-85904436 CATCAAAAATTATTTACCGAAGG - Intergenic
1132382383 15:101375246-101375268 CATCAAAAGTAATTTTGGCCGGG - Intronic
1134428981 16:14183070-14183092 CAAAAAGAATAATTTCGCCATGG + Intronic
1135157676 16:20067338-20067360 CATTAATAATAACTCGGCCAAGG + Intronic
1135388495 16:22067514-22067536 CATCAAAAACTATTAGGCCAGGG + Intronic
1135723447 16:24836124-24836146 ATTCCAAAATAATTTTGCCAAGG - Intergenic
1137746709 16:50826494-50826516 TGTCAAAAATAAATTGACCATGG + Intergenic
1139096520 16:63710996-63711018 AATGGAAAATATTTTGGCCAAGG - Intergenic
1141202218 16:81906880-81906902 CTACAAAAATAAGTTGGGCATGG + Intronic
1143035370 17:3992523-3992545 CAACAAAAATGAGCTGGCCATGG + Intergenic
1143216381 17:5228188-5228210 AATGAAAAATAAGTTGGGCATGG + Intronic
1143640816 17:8196193-8196215 ATACAAAAATAACTTGGCCAAGG + Intergenic
1144614984 17:16761176-16761198 AATTAAAAAAAATTTAGCCAGGG + Intronic
1146354648 17:32123835-32123857 AATCAAAAATAAACTGGGCATGG - Intergenic
1150186739 17:63190033-63190055 TGTTAAAAATCATTTGGCCAAGG + Intronic
1151256790 17:72883694-72883716 CATCAAAAAGACTTGGTCCAGGG + Intronic
1153668581 18:7388658-7388680 CATCAAAACTAATTTGAGCTTGG + Intergenic
1158739939 18:60129249-60129271 CATCAAAGATAATTTAGAAATGG + Intergenic
1158975045 18:62703551-62703573 CAACAAAAATTAGTTGGGCATGG - Intergenic
1159426542 18:68295850-68295872 CTTAAAAAATTATTTGGCTAAGG + Intergenic
1159729090 18:72002726-72002748 CATCTAAAATAATTTAACAAAGG - Intergenic
1162229277 19:9252107-9252129 CAACCAAAATAATGTGACCAAGG - Exonic
1163276058 19:16285015-16285037 CAACAAAAATTAGCTGGCCATGG + Intergenic
1163495336 19:17643314-17643336 AATAAAAAAAAATTTGCCCATGG - Intronic
1163954332 19:20621280-20621302 CAACAAAAATTAGTTGGGCATGG - Exonic
1165128349 19:33616846-33616868 AATAAAAAATTAGTTGGCCATGG + Intergenic
1167731788 19:51263600-51263622 CTACAAAAATTATTTGGCCATGG + Intronic
1167802484 19:51753643-51753665 CATAAAAAACAATTTCTCCATGG - Intronic
1168469678 19:56630024-56630046 CTTTGAATATAATTTGGCCATGG - Intergenic
925095512 2:1195796-1195818 AATTAAAAATAATTTTGCCTTGG - Intronic
927314448 2:21665578-21665600 AATCCAAAATTATTTGGGCATGG + Intergenic
928324339 2:30307748-30307770 CAACACAAATAATTTGTTCAAGG + Intronic
928548446 2:32349667-32349689 AATAAAAAATTATTTGGACATGG - Intergenic
928915471 2:36465613-36465635 AATAAAAAACAACTTGGCCACGG - Intronic
929629166 2:43441628-43441650 CATGAAAACTAATATGGTCATGG - Intronic
933123037 2:78566725-78566747 AATCCAAATTAATTTGGCCCAGG + Intergenic
934165244 2:89288393-89288415 CATCAGCAATGACTTGGCCAGGG - Intergenic
934202030 2:89894069-89894091 CATCAGCAATGACTTGGCCAGGG + Intergenic
935960440 2:108420451-108420473 AAACAAAAAAAATTAGGCCAGGG + Intergenic
936988274 2:118332854-118332876 CATCATAAAGAATTTAGGCAGGG + Intergenic
937794564 2:126001486-126001508 CAAAAAAAATCATTTTGCCAGGG - Intergenic
937935467 2:127240497-127240519 AAAAAAACATAATTTGGCCAGGG + Intergenic
938678391 2:133662727-133662749 TATTAAAAATAATTTGGTTATGG + Intergenic
939246232 2:139626611-139626633 CATAAAAAATTAGTTGGGCATGG + Intergenic
939246954 2:139637201-139637223 CATGAAAGATAATTTTTCCATGG - Intergenic
940774166 2:157869262-157869284 CAGAAAAAATAATCTGGCAAGGG + Intronic
941209211 2:162615412-162615434 CATTAAAAATATATTGGTCAAGG + Intronic
941436047 2:165474399-165474421 CATAAAAATTACTTTTGCCAGGG - Intronic
942165822 2:173239974-173239996 CTGCAAAAATTATTTGGCCTAGG + Intronic
942420738 2:175805001-175805023 CTTGAAAAATATTTTGGCCAGGG + Intergenic
942527507 2:176870368-176870390 TTTCAAAAATTAGTTGGCCATGG - Intergenic
942617462 2:177808830-177808852 CATGAAAAATAATCAGACCATGG + Intronic
943724197 2:191236156-191236178 CATTAAAACTGATTTTGCCAAGG - Intergenic
944626614 2:201576121-201576143 CCTCAAAAACAATGTGGGCATGG - Intronic
945127887 2:206533355-206533377 CAAAAAAAATTATTTGGGCATGG - Intronic
945714435 2:213339998-213340020 CATCAAACATAATTTGTATAAGG - Intronic
945731070 2:213535802-213535824 CATGAAAAAAAATGTGGTCAAGG - Intronic
946504969 2:220289322-220289344 CCTCAAGAATTATGTGGCCATGG - Intergenic
947176128 2:227369311-227369333 CACTCAAGATAATTTGGCCAGGG - Intronic
947338611 2:229113343-229113365 CATTAAAAGTAATTTGCCTAAGG - Intronic
947887857 2:233589647-233589669 CAGTAAAAATCAATTGGCCAAGG - Intergenic
947894079 2:233652673-233652695 CAGTAAAAATCAATTGGCCAAGG - Intronic
948556600 2:238815630-238815652 CATAAAAAAGAAATTGTCCAAGG + Intergenic
948606645 2:239139921-239139943 CAACAAAAAGAACATGGCCATGG + Intronic
948679211 2:239621198-239621220 CATCAAAAACACTTTGGCATTGG - Intergenic
1169231733 20:3894085-3894107 CACAAAAAATTAGTTGGCCATGG - Intronic
1169972367 20:11282194-11282216 CAAGAATAAGAATTTGGCCAGGG - Intergenic
1171130325 20:22646386-22646408 AATCAGAAATCATTTTGCCATGG - Intergenic
1172132903 20:32667589-32667611 CAACCAGAATAATTTTGCCAAGG + Intergenic
1172376765 20:34448607-34448629 CATTAAAAATAATTTCACTATGG - Intronic
1174770227 20:53292601-53292623 TATTAAAAAAAATCTGGCCATGG - Intronic
1174923988 20:54736658-54736680 CATCAAAAATTATTTGCATATGG + Intergenic
1176876359 21:14133826-14133848 CATCAATAATGATCTAGCCAAGG + Intronic
1177364076 21:20111409-20111431 CATGGAAGATAATTTTGCCATGG + Intergenic
1177475943 21:21622942-21622964 AATAAAAAATAATTTAGGCATGG + Intergenic
1177905671 21:26968368-26968390 CCTGAAGAATAATTTGGGCATGG - Intergenic
1178012044 21:28299403-28299425 GACCAACAATAATTTGGTCAGGG + Intergenic
1178527101 21:33340042-33340064 CATGAAAAATAAAGTGGGCATGG - Intronic
1178845733 21:36172604-36172626 CTACAAAAATTATCTGGCCATGG + Intronic
1182918587 22:34058814-34058836 TATGAGAAATAATTTGGCCAGGG - Intergenic
1184114380 22:42413757-42413779 CAACAACAAAAATTTGGCCAGGG + Intronic
949724800 3:7031626-7031648 CATGAAAAAGTATTTGGCCCTGG - Intronic
950777444 3:15362864-15362886 CATTTAAACTAATTTGACCAAGG + Intergenic
953166986 3:40474313-40474335 CATAGAAAATAATTTGGCATAGG - Intergenic
953276052 3:41499484-41499506 GATCAATAAAAATTTGCCCAAGG - Intronic
956061517 3:65352728-65352750 TACCAAAAATTATTTGGGCATGG + Intergenic
956346402 3:68284078-68284100 CTTTCAAAATAACTTGGCCAAGG - Intronic
956524627 3:70144099-70144121 CATCAAAAAATATTTGGAAAGGG + Intergenic
957706921 3:83800654-83800676 CATCAAATAAAATTTGACCTAGG + Intergenic
957811676 3:85229732-85229754 CACCAAAAATACTTTTGCTAGGG - Intronic
959402529 3:105920885-105920907 AATAAAAAATAATCTGGACATGG - Intergenic
960631815 3:119739935-119739957 CAACACAAATAATCTGGCTAAGG - Intronic
961190113 3:124953342-124953364 GATTAAAAATAATGTGCCCAGGG + Intronic
961495195 3:127286492-127286514 TTTCAAGAATAATTTGGCAATGG + Intergenic
962167000 3:133059808-133059830 CAAAAAAAATGATCTGGCCAGGG - Intronic
962177824 3:133173687-133173709 CCTAAAAAATAAAATGGCCAGGG + Intronic
962566182 3:136662599-136662621 AATCAAAAATTAGTTGGGCATGG - Intronic
963279002 3:143362989-143363011 GAACAAAAATAAATGGGCCAAGG - Intronic
963530114 3:146463838-146463860 CATAAAAAATAATTTTGAAATGG - Exonic
963885350 3:150575931-150575953 ATTCAAAAATTAGTTGGCCATGG + Intronic
964091936 3:152887733-152887755 CATAAACAATAACTTGGCCAGGG + Intergenic
964231232 3:154470497-154470519 CAGACAAAATAATTTGCCCAAGG - Intergenic
965730700 3:171769173-171769195 AAACAAAAATAATGTGGCAAAGG - Intronic
965908949 3:173746894-173746916 CATAAAAAATTAGTTGGGCATGG + Intronic
966514665 3:180805402-180805424 CATTAAAAATAATGTTGACATGG + Intronic
970689453 4:18605825-18605847 CATCAGAAATAATATCCCCATGG + Intergenic
970995791 4:22266445-22266467 CTTCAGAAGTCATTTGGCCAGGG - Intergenic
971137784 4:23888741-23888763 AAGTGAAAATAATTTGGCCAAGG - Intronic
971330700 4:25678877-25678899 CACCCAAAAAAATTCGGCCAGGG + Intergenic
971464179 4:26937148-26937170 AAGCAAAAATAATTTGGGAAAGG - Intronic
971887613 4:32473491-32473513 CACCAAGGAAAATTTGGCCAAGG - Intergenic
974223478 4:59007059-59007081 GATCTACAATAAATTGGCCATGG + Intergenic
974280949 4:59792300-59792322 CAGCAAGATCAATTTGGCCATGG + Intergenic
974333793 4:60513154-60513176 GATATTAAATAATTTGGCCAAGG - Intergenic
975760141 4:77612192-77612214 GATCTAAAATCATTTGGCAAAGG + Intergenic
975892112 4:79042357-79042379 TTTCATAGATAATTTGGCCAAGG - Intergenic
976419329 4:84821459-84821481 CATCAAGGATGATTTGGGCAAGG + Exonic
978716667 4:111852193-111852215 CATGAAAAATAATATGCTCATGG + Intergenic
978797741 4:112725124-112725146 CAAAAAAAATTAGTTGGCCATGG + Intergenic
978810315 4:112842303-112842325 CATTGAAAATAATTTGGGCCGGG - Intronic
979863149 4:125719627-125719649 CATATAAAATAATTTGTCCAAGG - Intergenic
980805697 4:137810712-137810734 CATGAGAAATAATTTGCTCAAGG - Intergenic
981529861 4:145741850-145741872 CAACAAAAATTAGTTGGGCATGG - Intronic
981890291 4:149728317-149728339 CATCACAAGTAAATTGGACATGG - Intergenic
982638666 4:157928507-157928529 AATGAAAAATAATTTGAACATGG - Intergenic
983206375 4:164914581-164914603 CATAAAAAATTATCTGGGCATGG - Intergenic
983418210 4:167484676-167484698 CAGAAGAAATAATTTGACCAAGG + Intergenic
983937649 4:173513667-173513689 CACCAAATACAATTTGGGCAAGG - Intergenic
984275308 4:177602532-177602554 CATAAAAAATAATGGGGCTATGG + Intergenic
984750226 4:183265262-183265284 TATCAAAAATGACTTAGCCATGG + Intronic
986263420 5:6169104-6169126 CATTAAAAATAAATTAGGCAAGG + Intergenic
986461859 5:7980677-7980699 CACCAACAAAAATTTGGCCATGG + Intergenic
986535541 5:8783164-8783186 CATTGAAAATAATGTGGGCAGGG - Intergenic
988735036 5:34012084-34012106 CATAAATAATCCTTTGGCCAGGG + Intronic
989297178 5:39842825-39842847 AATCTAAAATAAGTTGACCAGGG - Intergenic
990876817 5:60495130-60495152 CCTCAAAAGCAATTTGGCCATGG + Intronic
991461102 5:66860099-66860121 ATTCAAATCTAATTTGGCCAGGG - Intronic
992476126 5:77103183-77103205 CATCTAAAATTATTTGACCTTGG + Intergenic
992704588 5:79377937-79377959 CAAGAAAAATAATTAGGGCAAGG + Intronic
992814112 5:80419232-80419254 CATAAAAAATAAGCTGGACATGG - Intronic
993845313 5:92935054-92935076 CACCAAAAATACTTGTGCCAGGG + Intergenic
995056247 5:107762394-107762416 ATTCCAAAATAAATTGGCCATGG - Intergenic
995655415 5:114420932-114420954 CATCAAAAATAATGTGGAAGGGG - Intronic
997787254 5:136724815-136724837 CAACACAAATAATATGGTCACGG - Intergenic
998345663 5:141460543-141460565 AATCAAAAATCATTTGGCCATGG + Intronic
998762243 5:145445232-145445254 CATCAAAAATCAGTTGGCTGTGG - Intergenic
998792892 5:145784686-145784708 CATCAAAAATCATGTTTCCAAGG + Intronic
998825476 5:146097028-146097050 CTTCAAAAATATTTTACCCAGGG + Intronic
998846329 5:146313983-146314005 CATTAAAAATAATGTGGGCTGGG + Intronic
998921836 5:147077664-147077686 CATCTAAGATATGTTGGCCAGGG + Intronic
998957112 5:147450158-147450180 AATAAAAAATAATTTGCTCAGGG - Intronic
999055380 5:148569840-148569862 AATCATAAATATTTTGGGCAGGG + Intronic
999915509 5:156254689-156254711 AATAAAAAATTATTTGGGCATGG + Intronic
1000166328 5:158652643-158652665 CTTCACAAGAAATTTGGCCAAGG - Intergenic
1001153226 5:169250450-169250472 GAGGAAAAATAATTTGCCCAAGG + Intronic
1002127910 5:177060510-177060532 AATCAAAAATAAGTTGGGCTGGG + Intronic
1002964647 6:1951536-1951558 CATTAAAAATCATGTGGCAATGG - Intronic
1004893312 6:20122626-20122648 CCTTAAAAATAATTTGGACTGGG + Intronic
1006700799 6:35971649-35971671 GAGCAAAATTAATTTGCCCAAGG + Intronic
1008420655 6:51295465-51295487 TAATAAACATAATTTGGCCAAGG + Intergenic
1009531610 6:64824423-64824445 CATCAAAAACAACCTAGCCAAGG + Intronic
1009892303 6:69701150-69701172 TACCAAAAATAATTTGGAGAAGG + Intronic
1010128662 6:72465473-72465495 CATCAAGAAATATCTGGCCAAGG + Intergenic
1010703897 6:79084644-79084666 CATCTTAAATAATTTTGCCCAGG - Intergenic
1010835656 6:80585124-80585146 CTTAAAAAATTATTTGACCATGG - Intergenic
1011096865 6:83675894-83675916 TGTCAAAAAAGATTTGGCCATGG + Intronic
1011849664 6:91610707-91610729 CAGCAAAAATAACTCAGCCAAGG + Intergenic
1012812495 6:103978154-103978176 TTACAAAAATAATTTGCCCAAGG + Intergenic
1014597573 6:123364181-123364203 TGTTAAATATAATTTGGCCAAGG + Intronic
1014692210 6:124575702-124575724 CATGAAAAAAAATATAGCCAAGG - Intronic
1014695780 6:124619660-124619682 CATGACAAATGATTTGGCTAGGG + Intronic
1015078732 6:129196790-129196812 CATCAAGACTAACTTGGCAATGG + Intronic
1015280179 6:131425315-131425337 CATAAAAAAGAATTTGTCTAAGG + Intergenic
1015438687 6:133221711-133221733 AATTAAAAATAAATTTGCCAGGG - Intergenic
1015453851 6:133402597-133402619 CATCAAAATGAATTTGCTCAGGG - Intronic
1015666276 6:135633199-135633221 CATTAAAAATTTTGTGGCCATGG + Intergenic
1015734068 6:136378520-136378542 CAATATAAAAAATTTGGCCAAGG + Intronic
1015778236 6:136836655-136836677 GAACAAAAATAATTAGGCCTGGG + Intronic
1015945359 6:138494945-138494967 CATCAACAATAAATTGGGCCGGG + Intronic
1016276566 6:142360096-142360118 CATCTCAAATAATTTGCCAAGGG - Intronic
1016363215 6:143290151-143290173 CAGAAGAAATAATTTGACCAAGG + Intronic
1016639087 6:146328029-146328051 CATCACAATTTATTTGGTCAGGG + Intronic
1018219464 6:161564027-161564049 AAACAAAAATGATTTGTCCAAGG + Intronic
1018328049 6:162695741-162695763 GAGCAAAAATAATTGGGCCTTGG + Intronic
1018408938 6:163521498-163521520 CATCACAAATAATTTGGGGCAGG + Intronic
1020022326 7:4876594-4876616 CATAAAAAATAATTTTGGCCAGG - Intronic
1020362518 7:7343850-7343872 AATCAAAAATTAGTTGGACATGG + Intergenic
1021279619 7:18701635-18701657 CATTATAAATAATTTCGTCATGG + Intronic
1021673847 7:23060763-23060785 CAGCTGAAATAATTTGGCCAAGG + Intergenic
1022932255 7:35130905-35130927 CATCAAAAAAAATTCTGCCAAGG - Intergenic
1024459311 7:49643830-49643852 CATCAAACACAATTTGCCCTAGG + Intergenic
1025966142 7:66273956-66273978 CAACAAAAATTAGTTGGGCATGG - Intronic
1026629123 7:72022377-72022399 CAAAAATAATAATTTGGCTAGGG - Intronic
1027822100 7:83060070-83060092 GATCAAAAATAACTTTGCCAGGG - Intronic
1027928324 7:84497044-84497066 CCTAAAAAATAATCTGGCCAAGG + Intergenic
1029828186 7:103223705-103223727 CATCAAAAAAAATTCTGCCAAGG - Intergenic
1030375318 7:108746567-108746589 GTTCAAAACTAATTTTGCCAGGG - Intergenic
1031111668 7:117618022-117618044 CAAGAAGAATAATTTGTCCATGG - Intronic
1032948919 7:136885145-136885167 AAGGAAAAATAATTTGGACAGGG + Intronic
1033111586 7:138583322-138583344 CATTAAAAATAATTGGGGCTGGG + Intronic
1033578347 7:142708617-142708639 CACCAAAACCAATATGGCCATGG + Intergenic
1034030201 7:147753641-147753663 CATGAAAAATAATTCGGTAATGG + Intronic
1034284966 7:149878592-149878614 CATCCAAAATAATATGACCGAGG + Intronic
1034285038 7:149878860-149878882 CATCCAAAATAATATGACCGAGG - Intronic
1037230124 8:16648308-16648330 CATCAAAAAATATTTGTCCATGG + Intergenic
1039837900 8:41271460-41271482 CATCCAAAAAAATTCGGCCAGGG + Intronic
1040430656 8:47338787-47338809 CACAAAAAATTATTTGCCCAGGG + Intronic
1041856211 8:62458388-62458410 CATCAAAACCTATTTGTCCATGG + Intronic
1042892754 8:73631197-73631219 CATAAAAAATTATCTGGGCATGG + Intronic
1043850808 8:85214186-85214208 CATCAAAAACAAGTTGGCCAAGG + Exonic
1044323272 8:90830516-90830538 CAGCAATACAAATTTGGCCAAGG + Intronic
1045219555 8:100185117-100185139 CATCAAAAATGCTTTTCCCATGG + Intronic
1045352311 8:101352971-101352993 AAAAAAAAAAAATTTGGCCATGG + Intergenic
1046647826 8:116805162-116805184 CATGTAAAATAATTAGTCCAGGG + Intronic
1046809833 8:118520898-118520920 CATAAAAAATAATTAGGACAAGG + Intronic
1047511301 8:125517813-125517835 CATCAAAAAGAAGATGGCCTGGG - Intergenic
1051000914 9:12280728-12280750 CATCAAAGACAATTTTTCCATGG + Intergenic
1051939217 9:22484749-22484771 CAGAAGAAATAATTTGACCAAGG + Intergenic
1051973556 9:22921322-22921344 GAGCAAAAATAAATTGGCCTAGG - Intergenic
1052147162 9:25063535-25063557 CATAAAAAAAAAGTGGGCCAAGG - Intergenic
1052161786 9:25271212-25271234 AATCAAAAAGAATTTGGCTGTGG + Intergenic
1053804722 9:41789784-41789806 TATTAAAAATAATTTGGTTAAGG + Intergenic
1054140561 9:61525679-61525701 TATTAAAAATAATTTGGTTAAGG - Intergenic
1054339362 9:63843744-63843766 CAAAAAAAATTATTTGGGCATGG - Intergenic
1055310928 9:74978709-74978731 CCTCAAAAATAATGTCACCATGG + Intergenic
1055694857 9:78872694-78872716 AATAAAAAAAAATTTGCCCAGGG - Intergenic
1055772887 9:79736455-79736477 GAGCTAAAATAATTGGGCCACGG + Intergenic
1056946323 9:91000516-91000538 TATAAAAACTAATCTGGCCATGG - Intergenic
1058201746 9:102050930-102050952 CCTCAAAAACATTTTCGCCATGG + Intergenic
1058262232 9:102849161-102849183 GATTAAAAATAATTATGCCAAGG - Intergenic
1058314772 9:103551986-103552008 AATCTAAAAGAATTTGTCCATGG + Intergenic
1058804900 9:108581409-108581431 AATCAAAAATTATCTGACCATGG + Intergenic
1058922063 9:109626608-109626630 CAAGAAAAATAATTTGGTCCAGG - Intergenic
1058982104 9:110179620-110179642 CAAACAAAATAAATTGGCCAAGG - Intergenic
1059214091 9:112543861-112543883 CAGCAAATATAAATTGGACATGG - Intronic
1059775192 9:117467487-117467509 TATAAAAAATTATCTGGCCATGG - Intergenic
1059982640 9:119790067-119790089 CAGCAAGAATAACTTGGCAATGG + Intergenic
1060739670 9:126090061-126090083 CACCAGAAATACTTGGGCCAAGG - Intergenic
1185819352 X:3186793-3186815 CAGCAATACTAATGTGGCCATGG + Intergenic
1186158239 X:6748349-6748371 CATCAACAGTAATGTGACCATGG - Intergenic
1186749611 X:12607620-12607642 TAGGAAAAATAACTTGGCCAAGG - Intronic
1187138192 X:16568704-16568726 AATAAAAAATTAGTTGGCCATGG - Intergenic
1187790497 X:22945088-22945110 AACCAAATATAAGTTGGCCATGG - Intergenic
1188470234 X:30529925-30529947 CTTCATAAATAATTTGCACATGG - Intergenic
1188915861 X:35909696-35909718 TATCAAATATATTTTGGCTATGG - Intergenic
1189810325 X:44775447-44775469 CAACAGAAATAATTTGGTGATGG + Intergenic
1191782884 X:64887237-64887259 CATCAATAAGTATTTGGCTAGGG - Intergenic
1192128022 X:68520625-68520647 AATAAAAAATTAGTTGGCCATGG - Intronic
1193787504 X:85777640-85777662 CATCAATAATTATTTGCCCTAGG + Intergenic
1194273107 X:91844802-91844824 CATTTAAAATAGTTTGACCAGGG + Intronic
1195035584 X:100968791-100968813 AATAAAAAATAAATTAGCCAAGG + Intergenic
1195867758 X:109451663-109451685 CATCACATATCATTTGGGCAAGG + Intronic
1196196846 X:112845826-112845848 CTTCAAGAAGAATCTGGCCAGGG - Intergenic
1197528432 X:127592071-127592093 CATCAAAAATAATTCAGACCAGG + Intergenic
1197593269 X:128435703-128435725 CATGCTAAATAATTTGTCCAAGG + Intergenic
1198135772 X:133748965-133748987 AATAAAAAATAATTTGGGCACGG + Intronic
1198586906 X:138131880-138131902 CATTATAAGTAATTTGCCCAAGG + Intergenic
1199606024 X:149580270-149580292 CATCAAATACAATTTGGGGATGG - Intergenic
1199633097 X:149789098-149789120 CATCAAATACAATTTGGGGATGG + Intergenic
1200425079 Y:3011352-3011374 CATTAAAAATATTTTGGCAGTGG - Intergenic
1200590350 Y:5066198-5066220 CATTTAAAATAGTTTGACCAGGG + Intronic
1202025393 Y:20517503-20517525 CATCAAAAAAAAAATGACCATGG - Intergenic
1202347539 Y:23949220-23949242 TCTCAAAACCAATTTGGCCAAGG + Intergenic
1202523233 Y:25720871-25720893 TCTCAAAACCAATTTGGCCAAGG - Intergenic