ID: 1084159788

View in Genome Browser
Species Human (GRCh38)
Location 11:67340918-67340940
Sequence CACTGTCATCAAAAATAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 364}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084159788_1084159792 2 Left 1084159788 11:67340918-67340940 CCAAATTATTTTTGATGACAGTG 0: 1
1: 0
2: 2
3: 31
4: 364
Right 1084159792 11:67340943-67340965 AACGTAATTAAGTGGGTAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 163
1084159788_1084159793 17 Left 1084159788 11:67340918-67340940 CCAAATTATTTTTGATGACAGTG 0: 1
1: 0
2: 2
3: 31
4: 364
Right 1084159793 11:67340958-67340980 GTAAAAGGTCTTTGAGCAAATGG 0: 1
1: 0
2: 0
3: 23
4: 201
1084159788_1084159795 19 Left 1084159788 11:67340918-67340940 CCAAATTATTTTTGATGACAGTG 0: 1
1: 0
2: 2
3: 31
4: 364
Right 1084159795 11:67340960-67340982 AAAAGGTCTTTGAGCAAATGGGG 0: 1
1: 0
2: 0
3: 28
4: 287
1084159788_1084159789 -6 Left 1084159788 11:67340918-67340940 CCAAATTATTTTTGATGACAGTG 0: 1
1: 0
2: 2
3: 31
4: 364
Right 1084159789 11:67340935-67340957 ACAGTGCCAACGTAATTAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 87
1084159788_1084159796 23 Left 1084159788 11:67340918-67340940 CCAAATTATTTTTGATGACAGTG 0: 1
1: 0
2: 2
3: 31
4: 364
Right 1084159796 11:67340964-67340986 GGTCTTTGAGCAAATGGGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 185
1084159788_1084159794 18 Left 1084159788 11:67340918-67340940 CCAAATTATTTTTGATGACAGTG 0: 1
1: 0
2: 2
3: 31
4: 364
Right 1084159794 11:67340959-67340981 TAAAAGGTCTTTGAGCAAATGGG 0: 1
1: 0
2: 2
3: 26
4: 239
1084159788_1084159790 -5 Left 1084159788 11:67340918-67340940 CCAAATTATTTTTGATGACAGTG 0: 1
1: 0
2: 2
3: 31
4: 364
Right 1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084159788 Original CRISPR CACTGTCATCAAAAATAATT TGG (reversed) Intronic
905149485 1:35916275-35916297 TAATGTCATCAAAGATAATTAGG + Intronic
906127145 1:43433770-43433792 CACTGTCTCAAAAAATAATAAGG + Intronic
907201670 1:52732101-52732123 CACTGTCATAAGAAAAAAATAGG - Intronic
907743349 1:57188566-57188588 TACTGTCATCAAAGATGATATGG + Intronic
908065456 1:60398789-60398811 CACTGCTTTCAGAAATAATTAGG - Intergenic
908151646 1:61308890-61308912 CTCAGTCATTCAAAATAATTAGG - Intronic
908369227 1:63464239-63464261 TACTGTTTTCAAAAATTATTTGG - Intronic
908855454 1:68421708-68421730 CCCTGATTTCAAAAATAATTTGG + Intergenic
908920902 1:69190522-69190544 CACAATAAACAAAAATAATTTGG + Intergenic
909299399 1:73992743-73992765 CACTGCCATAAAAAAAAAGTTGG - Intergenic
909506713 1:76399447-76399469 CACTTTCATCACAAACACTTGGG + Intronic
910190996 1:84595542-84595564 CGCACTCCTCAAAAATAATTGGG - Intergenic
911390208 1:97231980-97232002 CAGTGTCTTCAAAAAGAATCTGG - Intronic
911808393 1:102241694-102241716 CACAGACATCTAAGATAATTAGG - Intergenic
912432131 1:109633817-109633839 CATTTTCATTAAAAAAAATTTGG + Intergenic
912590168 1:110809983-110810005 CAGTAGCATAAAAAATAATTAGG + Intergenic
912903442 1:113677844-113677866 AAATGTGATAAAAAATAATTTGG - Intronic
913353903 1:117896711-117896733 GATTGTCATGAAAAATAAATTGG + Intronic
914371991 1:147033813-147033835 CACTGTCTTCAGAACTAACTTGG + Intergenic
914577525 1:148989001-148989023 CACTGTCTTCAGAACTAACTTGG - Intronic
916947045 1:169739296-169739318 CATTTTCATCAAATATATTTAGG - Intronic
918352779 1:183674912-183674934 CAGTATCTTCAAAAGTAATTAGG + Intronic
918357137 1:183715531-183715553 CACTAGCATCTTAAATAATTAGG + Intronic
918495912 1:185135737-185135759 TACTCCCTTCAAAAATAATTTGG - Intronic
918779215 1:188674805-188674827 CACCATAATCAAAAAGAATTAGG - Intergenic
918957428 1:191227624-191227646 CAAGATCATCACAAATAATTTGG + Intergenic
919143320 1:193601398-193601420 CAAAGTCTCCAAAAATAATTCGG - Intergenic
920023447 1:202973696-202973718 CACTCTCCTCAAAAATCAGTTGG + Intergenic
921234494 1:213111490-213111512 CACTGTTATAAAAAATAAATAGG - Intronic
921679822 1:218017899-218017921 CACTGTCATGGAGAAGAATTGGG - Intergenic
922248873 1:223828170-223828192 CATTGCCTTCAAAAATATTTTGG - Intronic
922405475 1:225308423-225308445 TATTGTCAATAAAAATAATTTGG + Intronic
923142545 1:231173239-231173261 CAATGTGATAAAAAATACTTAGG + Intronic
923169247 1:231398138-231398160 TACTGTCATCTAAAATATTTCGG - Intronic
1063950612 10:11219431-11219453 CACTGTCAAGGACAATAATTTGG + Intronic
1064770758 10:18719995-18720017 CACTGTCTTCAAAACTACTATGG + Intergenic
1065388956 10:25162549-25162571 CACTTTCATCTAGAACAATTAGG + Intergenic
1065764464 10:29014366-29014388 CACCTTCATCAAAAATTAGTTGG + Intergenic
1065992203 10:31022677-31022699 CATTGTCATGAAGAAGAATTGGG - Intronic
1066183071 10:32982005-32982027 CACTGTCGTCATAGATAATGTGG - Intronic
1067218148 10:44320360-44320382 CACTCTCATAAAAAATCAATTGG - Intergenic
1068026082 10:51646238-51646260 AACTGAGATCTAAAATAATTAGG - Intronic
1070488500 10:76953673-76953695 TTCACTCATCAAAAATAATTAGG + Intronic
1072428560 10:95351432-95351454 AACTGCCAACAAAAGTAATTAGG + Intronic
1073712427 10:106058965-106058987 CACTGTAAACAAAAATAAATTGG + Intergenic
1074973429 10:118561872-118561894 TACTGTCATCAAAAGTTACTTGG - Intergenic
1075136788 10:119793974-119793996 AAATGTCATCCAACATAATTAGG - Intronic
1075829873 10:125399589-125399611 CTCTGTCATTAAAAAGAATGTGG - Intergenic
1076491637 10:130865855-130865877 CACTGCCATCAAAAGCATTTAGG + Intergenic
1076607498 10:131698566-131698588 CAGTGTCATTAAACATCATTTGG + Intergenic
1077974202 11:7230002-7230024 TAATGCCATCATAAATAATTAGG - Intergenic
1077983293 11:7324115-7324137 CAATGAAATAAAAAATAATTTGG - Intronic
1079742812 11:24085223-24085245 CCCTCTCACCAAAGATAATTTGG + Intergenic
1079790014 11:24725155-24725177 AACTGTCAACAAAAACAATAGGG + Intronic
1081107962 11:39095350-39095372 CTCTGTAATCAAATATATTTAGG - Intergenic
1084159788 11:67340918-67340940 CACTGTCATCAAAAATAATTTGG - Intronic
1085371847 11:76014942-76014964 CACGGTCTCTAAAAATAATTAGG + Intronic
1085498997 11:77000695-77000717 CACTTTTGTCAAAAATTATTTGG + Intronic
1087352492 11:97050775-97050797 TGCTTTTATCAAAAATAATTTGG - Intergenic
1087416593 11:97864345-97864367 CACAGCCATAAAAAATAATGAGG + Intergenic
1088035253 11:105304287-105304309 ACCTGTCATCAAACAAAATTAGG + Intergenic
1088087505 11:105998913-105998935 TACAGTCATTAAAAATAATGAGG + Intronic
1089243677 11:117102317-117102339 CACTGTCATTGAGAATAACTTGG - Intergenic
1090663377 11:128897930-128897952 CACTTTTGTCAAAAATAAGTTGG + Intronic
1093487817 12:19671008-19671030 GAATGGCTTCAAAAATAATTAGG - Intronic
1094078885 12:26510838-26510860 CACACTCCTCAAAAATATTTCGG - Intronic
1097403863 12:59164042-59164064 TACTGTTATCAGAAAAAATTTGG + Intergenic
1098009753 12:66038043-66038065 TATTTGCATCAAAAATAATTTGG - Intergenic
1098181725 12:67854321-67854343 GACTGTCTTCAAAAAGGATTAGG + Intergenic
1099263978 12:80420254-80420276 CAATGTCAGCAGAAATAATTGGG - Intronic
1099400891 12:82202837-82202859 CACCTTCATCAAAAATGAGTTGG + Intergenic
1099724298 12:86405388-86405410 AACAGTCATAAAAAATACTTAGG + Intronic
1099755480 12:86842232-86842254 CATTGTCTTTAAAAATTATTGGG + Intergenic
1101357066 12:103989935-103989957 TACAGTCACTAAAAATAATTTGG - Intronic
1102556136 12:113727879-113727901 CACTGTCATTACAACTATTTTGG + Intergenic
1105822194 13:24089627-24089649 CACTGATATTAAAAATTATTTGG - Intronic
1106245469 13:27946020-27946042 CACTGTCATCTGAGATAATACGG + Intergenic
1106839014 13:33666593-33666615 CTCTGTCTTAAAAAATAAATAGG - Intergenic
1106907962 13:34428866-34428888 CACTCTCTTAAAAAATATTTTGG + Intergenic
1106964908 13:35051745-35051767 CACTGAAATTCAAAATAATTTGG - Intronic
1107129573 13:36880547-36880569 CACTGTCCTGAAAAGTAGTTTGG - Intronic
1107282480 13:38752734-38752756 CACTGTCATCACAATTAACATGG - Intronic
1107619736 13:42214001-42214023 CAATGTCATCATCAATAATATGG + Intronic
1107633638 13:42369516-42369538 CACAATCATCAAAAAGAATGGGG - Intergenic
1109581564 13:64345783-64345805 CAACTTCATCAAAAATAAGTTGG - Intergenic
1109647579 13:65279176-65279198 CACTGTTTTGAAAAATATTTAGG - Intergenic
1109855681 13:68124430-68124452 AGCTCTCATCAAAAATAAATTGG + Intergenic
1109897051 13:68706481-68706503 CACTGTCTTCCACAATAGTTGGG + Intergenic
1110194749 13:72775403-72775425 TATTGCCATTAAAAATAATTTGG - Intronic
1110646328 13:77889163-77889185 AAGTGTAATCAATAATAATTAGG - Intergenic
1111173667 13:84563696-84563718 CACTTTCATAATAAAAAATTAGG - Intergenic
1111435895 13:88207658-88207680 CAATGTTTTCAGAAATAATTTGG - Intergenic
1111750094 13:92318543-92318565 CACAGGCATTAAAAAAAATTAGG - Intronic
1112490782 13:99861387-99861409 AACTGTCATCACAAAGAATGGGG + Intronic
1113002057 13:105651828-105651850 CACCCTTGTCAAAAATAATTTGG - Intergenic
1114073750 14:19138176-19138198 CACTGAAATTCAAAATAATTTGG - Intergenic
1114088514 14:19261810-19261832 CACTGAAATTCAAAATAATTTGG + Intergenic
1114771882 14:25437036-25437058 ACCTGTCAACAAAAGTAATTAGG + Intergenic
1116209393 14:41914047-41914069 CAGTCTCATCAAAAATCAATTGG + Intergenic
1116348056 14:43821839-43821861 CTCTGTAATGAATAATAATTTGG + Intergenic
1116627318 14:47282070-47282092 CACTTTCTTCAACAATTATTTGG + Intronic
1117078071 14:52124052-52124074 CCCTGTAATCATAAAAAATTGGG + Intergenic
1117236101 14:53777521-53777543 CAATTTCATCAAAAATCAGTTGG - Intergenic
1117247290 14:53898889-53898911 TGCTGACATCAAAATTAATTAGG + Intergenic
1117279680 14:54226447-54226469 CACTTACATGAAAAATATTTGGG - Intergenic
1117727079 14:58685258-58685280 CACTGCTTTGAAAAATAATTTGG - Intergenic
1120555040 14:85919314-85919336 CATTGTGATGAAAAATATTTTGG - Intergenic
1120736850 14:88063027-88063049 TTCAGTCATCAAACATAATTTGG - Intergenic
1121466269 14:94117177-94117199 CACTGTCATCACAAAAACTTGGG + Intergenic
1121854856 14:97258724-97258746 CACTTTCAGCAAAAATAATGAGG + Intergenic
1124332112 15:28829705-28829727 CAATGTCAACAAAATTAATGGGG - Intergenic
1126236975 15:46397261-46397283 CACCTTCATCAAAAATCAGTTGG - Intergenic
1127779939 15:62303395-62303417 CCTTGACATCAGAAATAATTAGG - Intergenic
1127998015 15:64165606-64165628 TCCTGTGAACAAAAATAATTTGG - Exonic
1130626182 15:85517810-85517832 ATCTGTCAGCAAAACTAATTAGG + Intronic
1131869816 15:96751641-96751663 GACTTTTATCAAAAATAAGTTGG - Intergenic
1132269714 15:100512991-100513013 CACTGTTACTAAACATAATTGGG + Intronic
1133649271 16:7795408-7795430 CACTAGAATAAAAAATAATTAGG + Intergenic
1134893550 16:17863386-17863408 CACTGTCCTCAGAAATGTTTGGG + Intergenic
1134908485 16:18002751-18002773 CACTTTCATCAAACAAAGTTGGG + Intergenic
1135551658 16:23403127-23403149 CAATGCCTTGAAAAATAATTCGG + Intronic
1138842749 16:60528826-60528848 AACCGTCATCAAAAATAATGAGG + Intergenic
1139022340 16:62765439-62765461 TACTGAGAGCAAAAATAATTAGG - Intergenic
1141217212 16:82035813-82035835 CAGTGTCATGAAAAATACTTGGG - Intronic
1141358080 16:83368014-83368036 CAATATCATCAAATATACTTAGG - Intronic
1143715619 17:8766551-8766573 CATCGACATTAAAAATAATTTGG - Intergenic
1144542548 17:16158762-16158784 GATTCTCATCATAAATAATTTGG + Exonic
1145792866 17:27638747-27638769 AATTGCCATCAAAAGTAATTTGG + Intronic
1145832792 17:27930661-27930683 CACTTCCATCAAAACTCATTAGG + Intergenic
1149813358 17:59699652-59699674 CACTGTCATCACAAAGAAAAGGG - Exonic
1152170311 17:78741917-78741939 CACTGTCAGGAAAAGGAATTTGG + Intronic
1153113656 18:1626761-1626783 CCGTCTCATAAAAAATAATTAGG - Intergenic
1153726504 18:7962134-7962156 GACTGTCATCACAAAAAAATAGG - Intronic
1155719209 18:28990031-28990053 CACTTTCATCAAAAATCAATTGG + Intergenic
1155724102 18:29057557-29057579 CACTTACATCAAAAATGCTTGGG + Intergenic
1156007218 18:32456661-32456683 CAATGTTATCAAAAATGTTTTGG + Intronic
1156224658 18:35092325-35092347 CACTGTGGTCAAAAATCAGTTGG - Intronic
1157352651 18:46902921-46902943 CACCTTTATCAAAAATTATTTGG - Intronic
1158815027 18:61085284-61085306 TTCTGTCATCAAAAAAAAATGGG + Intergenic
1159043521 18:63346941-63346963 CCCTGTCATAAAAAAAAATGAGG + Intronic
1159638980 18:70841039-70841061 AACTTTCTTCAAAAATAACTTGG + Intergenic
1160283494 18:77516756-77516778 CAATGTCTTCAAAATTGATTTGG - Intergenic
1161773599 19:6244744-6244766 CCCTCTCATTAAAAAAAATTGGG - Intronic
1161846795 19:6716223-6716245 CCCTGTCTCAAAAAATAATTGGG - Intronic
1161877065 19:6919919-6919941 CACTGTCACCAAACAGAACTAGG + Intronic
1164663078 19:29995890-29995912 CACTCTTGTCAAAAATCATTTGG + Intronic
1164777796 19:30867113-30867135 CACTTTCACCAAAACGAATTGGG + Intergenic
1165171124 19:33892278-33892300 CAATGAAATCAAAAATAATAGGG + Intergenic
1165275339 19:34746198-34746220 CTCTGGCATCAAAGATAAATAGG + Intergenic
1166167416 19:41001469-41001491 CTCTGACATCAAAAAGAATCTGG - Intronic
1166272534 19:41724252-41724274 CACCGTTATCAAAAATCATTTGG + Intronic
1166379181 19:42346250-42346272 CAGTGACATCAAAAGTCATTGGG + Intronic
924976590 2:181451-181473 CAATTTTGTCAAAAATAATTTGG + Intergenic
925690475 2:6517794-6517816 CACTGTCATCATCTATAAATGGG - Intergenic
926587958 2:14709689-14709711 AACTGTTATGAAAAATAATAGGG + Intergenic
927282342 2:21320300-21320322 TACTGTCATTAAATAAAATTGGG - Intergenic
927658995 2:24976043-24976065 CACTGTGAACAAAGAAAATTTGG + Intergenic
930817189 2:55610294-55610316 CAATGTCATGAATAATAAATTGG - Intronic
931152625 2:59591929-59591951 TACTCTCATCAAAAATGTTTTGG + Intergenic
933042405 2:77486204-77486226 CATTGTCATCAGAAGTAAATAGG + Intronic
933358843 2:81251313-81251335 CACCTTTATCAAAAATAAGTTGG + Intergenic
933508660 2:83212088-83212110 CACTGTCATTAAGACAAATTAGG - Intergenic
933602628 2:84348316-84348338 CACTGTCAACCAAAGTATTTAGG - Intergenic
935633651 2:105232883-105232905 CACTTTTTTCAAAAATAAATTGG + Intergenic
935688195 2:105705222-105705244 CACTTTTGTCAAAAATAAGTTGG - Intergenic
935698201 2:105787768-105787790 CACTGTCATCAAGAAAAGATGGG - Intronic
936415185 2:112301291-112301313 CTCTGTCATAAAAAGGAATTTGG - Intronic
936469577 2:112786807-112786829 CACTGTCATCTAAATCATTTAGG + Intergenic
938487689 2:131729555-131729577 CACTGAAATTCAAAATAATTTGG - Intronic
939422512 2:141992166-141992188 AACTGTGATTAAAAATATTTGGG - Intronic
939446380 2:142314957-142314979 AACTATCATGAAAATTAATTTGG - Intergenic
939575912 2:143894294-143894316 CCCAGTCATCAAAAACAATATGG + Intergenic
939835115 2:147120512-147120534 CACTGTCACCCATTATAATTTGG - Intergenic
940086684 2:149867237-149867259 CACTTTTATCAAAAATCAGTTGG - Intergenic
940185222 2:150977318-150977340 CACTTGAATCAAAAATATTTTGG + Intergenic
940580059 2:155567590-155567612 CAGCTTCATCAAAAGTAATTTGG + Intergenic
943004199 2:182369751-182369773 CAGTGTCATAACAAATAAATTGG + Intronic
943212956 2:184991211-184991233 CACTTTTATCAAAAATCAGTTGG - Intergenic
943285004 2:185986754-185986776 CACGGTCACAAAACATAATTTGG + Intergenic
943328295 2:186527934-186527956 CACCGTTGTCAAAAATCATTTGG + Intergenic
944358109 2:198817866-198817888 CACTGTCAAAAAAATTAAATTGG + Intergenic
944727020 2:202481741-202481763 CACTGCTCTGAAAAATAATTAGG - Intronic
945395805 2:209315344-209315366 ATGTGTCTTCAAAAATAATTAGG + Intergenic
946103655 2:217350952-217350974 CACTGTCATAGAAAACACTTTGG - Intronic
946600919 2:221359067-221359089 CAGTGTCATAAAAGAAAATTAGG + Intergenic
947219868 2:227781822-227781844 CACTGTGATCAAATATGTTTGGG + Intergenic
1169164864 20:3414516-3414538 CACTGTTATAAAAAATACCTTGG + Intergenic
1169523667 20:6400167-6400189 CTATGTCATCAAAAGAAATTTGG + Intergenic
1169526756 20:6436645-6436667 CAATGACATCTTAAATAATTAGG - Intergenic
1169694099 20:8367982-8368004 CACTGTCATCAAGGGTAATGTGG - Intronic
1170400279 20:15975538-15975560 CTCTGTCATTACAATTAATTTGG - Intronic
1170524185 20:17221127-17221149 CACCTTCATAAAAAATGATTTGG + Intergenic
1170615553 20:17946482-17946504 GACAGGCATCAAAAATAACTTGG + Intronic
1171066099 20:22016976-22016998 CACTGGAATAAAAAATAACTTGG - Intergenic
1171567289 20:26207826-26207848 CACTGTAAGAAAAAATAATAGGG - Intergenic
1174951762 20:55050161-55050183 CACTGTCATAATAAATAAACTGG + Intergenic
1175659309 20:60798415-60798437 GACTGACATCAAAATGAATTTGG - Intergenic
1176367349 21:6041296-6041318 TACTCTCATCAAAAATCATCTGG + Intergenic
1177567266 21:22840758-22840780 CATTGTCATTTAAAATAATAGGG + Intergenic
1177580788 21:23020227-23020249 CACTCTCATTAAAAATAATCAGG + Intergenic
1179199730 21:39205468-39205490 CCCTGTCTTAAAAAATAAATAGG + Intronic
1179756169 21:43497250-43497272 TACTCTCATCAAAAATCATCTGG - Intergenic
1180492197 22:15860527-15860549 CACTGAAATTCAAAATAATTTGG - Intergenic
1180886357 22:19247278-19247300 CACTCTCATCAAAAATCAATTGG + Intronic
1181534802 22:23535870-23535892 CTCTGTCAGCAAAGAGAATTTGG - Intergenic
1182479297 22:30596618-30596640 CAGTTTTGTCAAAAATAATTTGG + Intronic
1183881659 22:40837307-40837329 CCCTGTCATAAAAAAAATTTAGG - Intronic
1184023363 22:41835634-41835656 CACTGTCTCTAAAAAAAATTAGG - Intronic
1185113110 22:48913602-48913624 CAAAGGCATCAAAAATAATCTGG - Intergenic
951373738 3:21887210-21887232 AAATGTCATCAAAGATATTTGGG + Intronic
952167496 3:30766667-30766689 CACTGTCATCAAAAACACACTGG - Intronic
955875361 3:63484243-63484265 CATTGTAATCACAAATAATAAGG - Intronic
956654903 3:71539709-71539731 CAATAGCATCAAAAATACTTAGG - Intronic
957111059 3:75958488-75958510 CACTGTAAGAAAAAATAATAGGG + Intronic
959053778 3:101549651-101549673 CACTGACTCTAAAAATAATTTGG + Intergenic
959440783 3:106372699-106372721 GACTGTCATCAAAAATCAACAGG - Intergenic
959525911 3:107376821-107376843 TATTTTCATAAAAAATAATTTGG - Intergenic
959608723 3:108270174-108270196 CAAAGTGATTAAAAATAATTGGG - Intergenic
960511253 3:118552286-118552308 CAGAGTCATGAAGAATAATTAGG + Intergenic
960804579 3:121571412-121571434 CAATAGCATCAAAAATAATTAGG + Intronic
962029821 3:131588093-131588115 CAATGACAACAAAAATTATTAGG + Intronic
962127056 3:132631478-132631500 CACTGTAATTAAAAATAAAGAGG + Exonic
963344197 3:144074272-144074294 CACTTTCCTCAAAGAAAATTGGG - Intergenic
963417058 3:145010150-145010172 CACTGTCATCAAGACAGATTAGG + Intergenic
963823705 3:149928452-149928474 CACTCTCATCAAAAATAAGTTGG + Intronic
964192911 3:154025935-154025957 CAAGGGCATCAAAAATACTTGGG + Intergenic
965126275 3:164634131-164634153 AACTTTTTTCAAAAATAATTAGG - Intergenic
965258507 3:166447828-166447850 CACTGACAGCAATGATAATTGGG - Intergenic
966263427 3:178007781-178007803 CAGTGATTTCAAAAATAATTTGG - Intergenic
967103067 3:186232638-186232660 CAATATCATTATAAATAATTTGG - Intronic
967329896 3:188279901-188279923 ACCTGTCATTAAAAATGATTCGG - Intronic
968190407 3:196663127-196663149 AACTGTCAGCAGAAATATTTAGG + Intronic
970167528 4:13255371-13255393 CACTGCCACTAAAATTAATTTGG + Intergenic
970696139 4:18679669-18679691 CACTGTCATTAAAGATGAGTAGG - Intergenic
970984083 4:22135298-22135320 CACTGTCTTCAAATTTAATTAGG - Intergenic
972128862 4:35803506-35803528 ATCTGTTATCAAAAATATTTAGG - Intergenic
974223071 4:59002068-59002090 TAAGGTCTTCAAAAATAATTAGG + Intergenic
974616417 4:64288840-64288862 CACTGTCATGGAGAAGAATTGGG - Intronic
974622240 4:64372812-64372834 AAATGTCATAAAAATTAATTTGG + Intronic
975538110 4:75473488-75473510 CACTGTCCTCAAAAAGTAATAGG + Intergenic
976163178 4:82225732-82225754 CATTGGCAACAGAAATAATTTGG + Intergenic
976640768 4:87335463-87335485 CAGTGTCATCACAAATTATAAGG - Intergenic
978100325 4:104831306-104831328 CACTGTAGTCAAAAATATTATGG - Intergenic
978636001 4:110808036-110808058 TGCTGTAATTAAAAATAATTTGG - Intergenic
979888008 4:126056139-126056161 TACTGACAGCAAAAGTAATTGGG + Intergenic
980161738 4:129172189-129172211 CACTGTCATTAAAATAAATTTGG + Intergenic
980450690 4:132967005-132967027 CATTTTCATCAATAATCATTTGG - Intergenic
980493543 4:133560956-133560978 CACTGCCATCAATACTATTTTGG + Intergenic
980687770 4:136253003-136253025 CACTTTCGTCAAAAATAAGTTGG + Intergenic
980832842 4:138152568-138152590 CAGAGTTATTAAAAATAATTTGG + Intergenic
982676927 4:158386873-158386895 CACTGTCATCTCAAATAATTAGG - Intronic
985769074 5:1797730-1797752 CACTGTCATCAACATGAATTTGG - Intergenic
986936543 5:12895147-12895169 CCCTGTCATCAATCATAATTGGG + Intergenic
987639180 5:20589532-20589554 CACTGTCACCTAAAGTAATAGGG - Intergenic
987673069 5:21038806-21038828 GACTGACATCAAATATAATTGGG + Intergenic
987954070 5:24715282-24715304 CAATGAGATCAAAAATTATTAGG + Intergenic
988194611 5:27987222-27987244 CAGTGTTATAAAAAATATTTTGG - Intergenic
988575437 5:32418899-32418921 CACTGTTTTCAAACATAATAAGG + Intronic
988789903 5:34597936-34597958 CCCTTTCCTCAAAAATTATTAGG - Intergenic
988996164 5:36716795-36716817 CCTTGTCATCTAAAAGAATTCGG + Intergenic
990282164 5:54262893-54262915 CACTGGCAACAAAAAGTATTTGG + Intronic
990439296 5:55828667-55828689 CACTGGCATCAAAAAGTCTTAGG + Intergenic
990831149 5:59959583-59959605 CAATGTCAACAAAAATAAGCAGG + Intronic
991512189 5:67391702-67391724 CACTAGCATCAAAAATATTACGG - Intergenic
992015408 5:72570223-72570245 CACTTTCATGAAATATAGTTTGG - Intergenic
992704586 5:79377931-79377953 AACTTTCAAGAAAAATAATTAGG + Intronic
992808936 5:80366594-80366616 CACTCTAATTAAAAACAATTTGG - Intergenic
992808956 5:80367049-80367071 CACTCTGATTAAAAACAATTTGG + Intergenic
993090439 5:83419678-83419700 AACTGTAATTAAAAATAAATAGG + Intergenic
993310307 5:86322448-86322470 CACTGTTATAAAACATTATTTGG - Intergenic
993335426 5:86652145-86652167 AACAGTCGTGAAAAATAATTTGG + Intergenic
994020926 5:95024825-95024847 CAATATCATAAAAAATACTTAGG + Intronic
994102600 5:95910208-95910230 GTCTGTCATCAAAAATAAGGAGG + Intronic
994500360 5:100568806-100568828 TACTGTGTTCATAAATAATTTGG + Intronic
996887274 5:128372461-128372483 CACTGTTATGAAAAACTATTAGG - Intronic
996988671 5:129601243-129601265 CATATTCATCAAATATAATTGGG + Intronic
997620901 5:135293478-135293500 CACAGGCATTAAAAATAATAAGG - Intronic
997827314 5:137118053-137118075 AACTGTCATCCAACATTATTGGG + Intronic
998345661 5:141460537-141460559 CACCTTAATCAAAAATCATTTGG + Intronic
998367784 5:141641898-141641920 CACTGTCCTCAACATTTATTGGG + Intronic
998846326 5:146313977-146313999 TGCTGTCATTAAAAATAATGTGG + Intronic
999156433 5:149460845-149460867 CACTATAATTAAAAAGAATTTGG - Intergenic
1000914915 5:167069830-167069852 CACTGTCATCACAGAAAATTTGG + Intergenic
1000960869 5:167599521-167599543 TACTGCCAGCAAAAATAGTTTGG + Intronic
1001725285 5:173891491-173891513 CACAGTGTTCAAAAATAAATGGG - Intronic
1005721068 6:28602526-28602548 CATTATCATCAAAAATTATTAGG - Intronic
1006864816 6:37200776-37200798 CACTGCCTTGAAAAATAAATTGG + Intergenic
1008867526 6:56231230-56231252 GACTATCTTCAAAAATAACTTGG + Intronic
1009578303 6:65495543-65495565 CATTGTCATCAAAGCTACTTTGG - Exonic
1009596429 6:65743598-65743620 AACTGGCTTCAAAAATACTTTGG - Intergenic
1010075667 6:71794238-71794260 CCCTTTCATCCAAAATATTTGGG - Intergenic
1010601962 6:77839692-77839714 CACTGGCAACCAAAATAATTAGG - Intronic
1011663292 6:89612352-89612374 CGCTGACCTCAAAAATAATGTGG + Exonic
1011722829 6:90176700-90176722 CTCTGTCACCAAAACTGATTTGG - Intronic
1011920430 6:92568810-92568832 CACTATAATGAAAAATAATTAGG + Intergenic
1013000249 6:106014844-106014866 TATTGTGATCAAAAATAGTTTGG + Intergenic
1013132661 6:107249334-107249356 CACTTTCTTCCAAAATATTTAGG - Intronic
1013832896 6:114295719-114295741 CACTGTCATTAAGAATACTAAGG - Intronic
1014160255 6:118159310-118159332 CAATGTCAACAAAACTACTTTGG - Intronic
1014518722 6:122411711-122411733 CACTGTTGTCAAAAATCCTTTGG + Intronic
1016115845 6:140284828-140284850 AACAGAAATCAAAAATAATTTGG + Intergenic
1016116711 6:140295051-140295073 CACTTTTATCAAAAATAAGTTGG - Intergenic
1016765593 6:147789756-147789778 CACAGTCATCAAAAACAAGGAGG - Intergenic
1016882366 6:148923584-148923606 AACTGTAACTAAAAATAATTAGG - Intronic
1016959756 6:149661860-149661882 CATTGTCATCAAAAAACCTTCGG + Exonic
1018788792 6:167130591-167130613 CACAGTCATTGAAAATGATTCGG - Intronic
1019151599 6:170009967-170009989 ATCTGTAATCAAAAATATTTTGG + Intergenic
1020258801 7:6518790-6518812 CACTGTGATCTAAAGGAATTTGG + Intronic
1020949422 7:14656460-14656482 CACTGTCAAGAAGATTAATTAGG - Intronic
1021283805 7:18754050-18754072 CACTGTAATCTAATATAATGAGG - Intronic
1021575947 7:22106089-22106111 CATTGTCATGAAGAAGAATTGGG + Intergenic
1022708303 7:32827373-32827395 CACTTTAAAGAAAAATAATTGGG - Intergenic
1022869986 7:34467022-34467044 CACCTTTATCAAAAATCATTTGG + Intergenic
1023532919 7:41177098-41177120 CACTGTCATCAGTAGAAATTTGG + Intergenic
1023594836 7:41817862-41817884 TACTATCATAAAAAATATTTAGG + Intergenic
1024910344 7:54440659-54440681 CACATTTATCAAAAATAACTTGG + Intergenic
1024935138 7:54704292-54704314 CACTGTCTTCAACATTAATGTGG - Intergenic
1025796804 7:64745573-64745595 CTTTGTTATCAAAAATAATATGG + Intergenic
1027388891 7:77685710-77685732 GACTGTCATCAGTAATAAATAGG + Intergenic
1027815844 7:82969596-82969618 AATTGTCACCAAAATTAATTTGG + Intronic
1027978738 7:85189393-85189415 TACTTTCATCAAAAGCAATTTGG + Intergenic
1028569697 7:92273328-92273350 CAATGACATCATAAAGAATTAGG + Intronic
1028717816 7:93993687-93993709 CATTATCATCAAAAATTATTAGG + Exonic
1029340293 7:99937448-99937470 CACTCTTATCAAAAATAAATTGG + Intergenic
1030410747 7:109176581-109176603 CATTGTCACCAAATAGAATTGGG + Intergenic
1030496861 7:110311423-110311445 CACTGTCATCACTAATCATCAGG + Intergenic
1030729289 7:112966017-112966039 CACGCTCATCTAAAATAATTTGG + Intergenic
1033490987 7:141843371-141843393 CAATTTTATCAAAAATAATCTGG + Intergenic
1035101959 7:156405479-156405501 CACTGTAAGCAAAAATTAATTGG - Intergenic
1036806736 8:11840095-11840117 CACTGACACCAAAATTAGTTTGG + Intergenic
1037047941 8:14333082-14333104 CACTGTCAGCAAAAATCAACTGG + Intronic
1037355029 8:18009509-18009531 TACTGTCTTTAAAAATTATTTGG + Intronic
1039105932 8:33989682-33989704 TACTGTCCTAAAAAATATTTTGG - Intergenic
1039356312 8:36820484-36820506 CACTGTCACCAGCAATAATATGG + Intronic
1040583908 8:48721916-48721938 CACAGGCAGCAAAAATAAGTGGG + Intronic
1041832640 8:62172980-62173002 CAAAGTCAACAAAAATAATGGGG - Intergenic
1041920109 8:63172427-63172449 AACTGTAATTTAAAATAATTAGG + Intronic
1042602834 8:70515395-70515417 CTCTGTCCTAAAAAATAATTAGG - Intergenic
1043009193 8:74860406-74860428 CAATGTTCTGAAAAATAATTAGG + Intergenic
1043352968 8:79382834-79382856 CACTTCCTTCAAAAATAAATGGG - Intergenic
1043749057 8:83912201-83912223 CAATTTTGTCAAAAATAATTTGG + Intergenic
1043802702 8:84630663-84630685 TAATGTCAGCAAAAATATTTTGG - Intronic
1044233467 8:89805129-89805151 CACTGAAAACAAAAATATTTTGG - Intergenic
1044578453 8:93797538-93797560 CACTGTCATGAAAACTTAGTTGG - Intronic
1044658046 8:94568981-94569003 TTCTGTGATCAAAAATCATTTGG + Intergenic
1045285329 8:100785688-100785710 CATTGTCCTTAAAAATTATTTGG - Intergenic
1046242936 8:111522099-111522121 CAGTCTCTTCAAAAATAGTTGGG - Intergenic
1047099425 8:121659698-121659720 CACAGTCTTCAATAATCATTGGG + Intergenic
1047620018 8:126596695-126596717 CACTTTCAACAAAAAGAATGTGG - Intergenic
1048552571 8:135447484-135447506 CAATGACATGAAAAGTAATTGGG - Intergenic
1048760391 8:137788208-137788230 CACTGTCATAGATAAAAATTTGG - Intergenic
1049987337 9:963695-963717 CACTAACATTTAAAATAATTAGG - Intronic
1050191293 9:3029352-3029374 CACTTCCATCAAAATTCATTAGG + Intergenic
1050649452 9:7759663-7759685 AACTCACATCAAAAATATTTGGG - Intergenic
1050861178 9:10432864-10432886 CACTATGAGCAAAAATAATGAGG - Intronic
1051378538 9:16430915-16430937 CACCCTCAGCAAATATAATTTGG + Intronic
1051573861 9:18592002-18592024 CATTGTCATGAAGAAAAATTGGG + Intronic
1052296094 9:26897291-26897313 CACTGTCCTGAATAAAAATTTGG + Intergenic
1052655369 9:31352116-31352138 CACTGTAAAAAAAAATAATAAGG - Intergenic
1055700627 9:78941489-78941511 AACTGAGATCCAAAATAATTAGG - Intergenic
1055718879 9:79149260-79149282 AACTGTCATCGAAAATAGTGTGG + Intergenic
1055735357 9:79323025-79323047 CACTCTTATCAAAAAGTATTTGG + Intergenic
1056099765 9:83290112-83290134 CACTGTAATCACAATTAAATTGG - Intronic
1057506607 9:95638910-95638932 CACACTCATCAAAAATTATTTGG - Intergenic
1057578689 9:96266279-96266301 GACTGTCTCCAAAAACAATTTGG - Intronic
1058572525 9:106362499-106362521 CAATAGCATCAAAAATATTTAGG - Intergenic
1059210439 9:112509858-112509880 CACTGTGATGAAAAATTATGTGG + Intronic
1059656464 9:116362114-116362136 CTCTGTCATAAATAATAATCTGG - Intronic
1060318877 9:122536826-122536848 CAAAGTCAACAAAAATAAATGGG - Intergenic
1061245613 9:129400001-129400023 CTCTGTCAGCAAAGAGAATTTGG + Intergenic
1061381282 9:130259728-130259750 CACTTTCCTCAAAAATCAATTGG + Intergenic
1062254822 9:135615898-135615920 CACTGTCAGCAAAAGAAAATCGG + Intergenic
1186148393 X:6648350-6648372 TACTGTAATAAAAAATAAGTAGG + Intergenic
1186668157 X:11740222-11740244 CACTGTCATCAAACACAAACAGG - Intergenic
1186820478 X:13282861-13282883 CACTGTCACAAGAAAGAATTTGG - Intergenic
1189768717 X:44400008-44400030 AACTGCCATCTAAAATAGTTTGG + Intergenic
1190336320 X:49264801-49264823 CACACTCATCGAAAAAAATTTGG - Exonic
1190444351 X:50508303-50508325 CACTGTCATCAAAGACCAGTTGG + Intergenic
1192074677 X:67980937-67980959 CACTCTCACCAAGAAAAATTGGG + Intergenic
1192132962 X:68570031-68570053 CACTGTCACCTGAAATTATTTGG + Intergenic
1192175584 X:68883002-68883024 CATTGTCATAAGAACTAATTTGG - Intergenic
1194330004 X:92570521-92570543 CACTGTATGCAAAAGTAATTAGG + Intronic
1194816802 X:98452050-98452072 CAATGTCATGAAAAATAAAATGG - Intergenic
1194843426 X:98774274-98774296 CACTGTAATCACTAATAATCAGG - Intergenic
1196079538 X:111616663-111616685 AATTGTCATCAAAATTAAATTGG - Intergenic
1196121210 X:112052895-112052917 CACTCTTGTCAAAAATCATTTGG + Intronic
1196570424 X:117260580-117260602 TACTGTGATCAAAAATAATATGG + Intergenic
1197238700 X:124097912-124097934 AACTGTGATCAAAATTAATATGG + Intronic
1197282841 X:124557622-124557644 AACTGGCATCAAAAATCAATGGG - Intronic
1197315461 X:124960591-124960613 CAGTTTCATCAAAAGGAATTTGG - Intronic
1197636402 X:128919656-128919678 CACTGCCATCAATAATCATCTGG - Intergenic
1197690199 X:129491514-129491536 AACTTTCATAAAAAACAATTTGG - Intronic
1198484424 X:137072538-137072560 CACTGGCATATAAAATGATTTGG + Intergenic
1199016732 X:142825730-142825752 CCCTGAAATCAAAAATAATAAGG + Intergenic
1199461057 X:148085378-148085400 CACTGTGATAATAAATATTTTGG - Intergenic
1199615076 X:149649683-149649705 GAGTGTCATCAAAAATTATAAGG - Intergenic
1199623092 X:149716236-149716258 GAGTGTCATCAAAAATTATGAGG + Exonic
1200638713 Y:5689702-5689724 CACTGTATGCAAAAGTAATTAGG + Intronic