ID: 1084159790

View in Genome Browser
Species Human (GRCh38)
Location 11:67340936-67340958
Sequence CAGTGCCAACGTAATTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084159788_1084159790 -5 Left 1084159788 11:67340918-67340940 CCAAATTATTTTTGATGACAGTG 0: 1
1: 0
2: 2
3: 31
4: 364
Right 1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1084159786_1084159790 6 Left 1084159786 11:67340907-67340929 CCTGGCCATGGCCAAATTATTTT 0: 1
1: 0
2: 4
3: 48
4: 424
Right 1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1084159785_1084159790 14 Left 1084159785 11:67340899-67340921 CCACTGCACCTGGCCATGGCCAA 0: 1
1: 6
2: 47
3: 391
4: 2128
Right 1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1084159787_1084159790 1 Left 1084159787 11:67340912-67340934 CCATGGCCAAATTATTTTTGATG 0: 1
1: 0
2: 2
3: 29
4: 349
Right 1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084159790 Original CRISPR CAGTGCCAACGTAATTAAGT GGG Intronic
901817375 1:11802499-11802521 AAGTGCTAATGTAATTCAGTTGG + Intronic
901846932 1:11989249-11989271 CAGTGACAAAGTGCTTAAGTGGG - Exonic
902998478 1:20246929-20246951 CAGTGAAAACTAAATTAAGTTGG - Intergenic
908086333 1:60638509-60638531 TAGTGCCAAAGTTATTTAGTGGG + Intergenic
912568945 1:110607685-110607707 TCCTGCCAACGTAATGAAGTAGG + Intronic
916527391 1:165624020-165624042 CAGTGGAAACTTTATTAAGTTGG + Intergenic
918687692 1:187439424-187439446 AATTGCCAACATAATTAAATGGG - Intergenic
919135979 1:193508182-193508204 CAGTGCTAAAGTCATTAAATGGG - Intergenic
922114085 1:222592745-222592767 CAATGTCAACGTGATTAAGGTGG + Intergenic
924220307 1:241867687-241867709 CTGTGCCAAGGCAATTAAATGGG - Intronic
1062941629 10:1426249-1426271 CAGTGCCAGCCTCATTAGGTCGG + Intronic
1063494815 10:6497207-6497229 CAGTGCCGACGTAAGTAAGAGGG - Exonic
1064465923 10:15581882-15581904 AGGTGCCAAAGTAATTCAGTGGG + Intronic
1064736889 10:18391164-18391186 AAATGCCAACTTAATTAACTTGG - Intronic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1071020676 10:81051241-81051263 TAGTGCCAAGGCAATTTAGTAGG + Intergenic
1074744435 10:116517580-116517602 CAGTGCCATGGTAATACAGTCGG - Intergenic
1078784128 11:14471307-14471329 CAGTGCAAACATTATTAACTCGG + Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1086496742 11:87411863-87411885 CAGTGCTACCGGAATTTAGTGGG - Intergenic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1093399091 12:18721562-18721584 CAGTGCCAAAGTAATTGTTTTGG + Intronic
1099434079 12:82622869-82622891 CTGTGCCAACGTAATGTATTAGG + Intergenic
1100481488 12:94983860-94983882 GAGTGCAAAAGTCATTAAGTGGG + Intronic
1113148171 13:107232176-107232198 CAAAGCCAAGGTAATTAGGTAGG + Intronic
1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG + Intronic
1116559764 14:46362936-46362958 CAGTTCCAACTTGGTTAAGTTGG + Intergenic
1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG + Intronic
1120915321 14:89705345-89705367 TAGTGGCAAGTTAATTAAGTAGG - Intergenic
1120963083 14:90142667-90142689 CAGTGCCAAGGCAATTCACTTGG - Intronic
1125584507 15:40810519-40810541 CAGGGCCCACATAATCAAGTAGG - Intronic
1131749454 15:95490951-95490973 CACTGTCAATGTCATTAAGTAGG - Intergenic
1135994061 16:27235276-27235298 CAATGCCACCGTAGATAAGTTGG - Exonic
1141541863 16:84729784-84729806 CAGTGTTAAGGAAATTAAGTTGG + Intronic
1145297891 17:21608757-21608779 CAGTGCCAAATTAAGTAAGATGG + Intergenic
1145352367 17:22094641-22094663 CAGTGCCAAATTAAGTAAGATGG - Intergenic
1151094577 17:71481645-71481667 CATTGCCAAGTTAATAAAGTAGG - Intergenic
1160201956 18:76803009-76803031 CAGTGGCAATGTAATTAATGAGG + Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
925695534 2:6573898-6573920 CAGGGCCAACTTAAGTAAATTGG + Intergenic
931904655 2:66829581-66829603 CAGTGCCATCGTGAGTAAATGGG - Intergenic
937376286 2:121338019-121338041 CAGTGCCAACATAACTATTTTGG + Exonic
942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG + Intronic
1173889012 20:46489168-46489190 CAGTACCAACATGATGAAGTTGG + Intergenic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1178127590 21:29532186-29532208 CATTGCCAAGGTGCTTAAGTAGG - Intronic
1181543604 22:23587848-23587870 CAGTGCAGACGCAATTAAGGTGG - Intergenic
956237041 3:67083868-67083890 GAGTTCCAATGTAATTGAGTTGG + Intergenic
960662018 3:120070822-120070844 CAGTGCCAACGTAGTTCAAAAGG + Intronic
963242344 3:143019546-143019568 AAGTGCCAACATAATTTAATAGG - Intronic
970963703 4:21903078-21903100 CAGTGGCTACGTGATAAAGTAGG - Intronic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG + Intergenic
971721445 4:30250151-30250173 CAGTAACACCGTAATCAAGTGGG - Intergenic
971871840 4:32251018-32251040 CAGTGGCAAGGTAATTAGCTGGG - Intergenic
971999071 4:34006463-34006485 CAGTGCCAAATTAAGTAAGATGG + Intergenic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
984217371 4:176931076-176931098 GAGTGCCAACTTGATTTAGTTGG - Intergenic
984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG + Intergenic
989654144 5:43726465-43726487 CAGGGCCCAATTAATTAAGTAGG + Intergenic
992983013 5:82196654-82196676 GGGTGCCAAGATAATTAAGTGGG - Intronic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG + Intronic
1016179675 6:141129606-141129628 AAGTGCCAAGGTAATGAAATAGG + Intergenic
1016697400 6:147013700-147013722 TGGTGCCAAGGTAATTCAGTTGG + Intergenic
1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG + Intergenic
1025275109 7:57575484-57575506 CAGTGCCAAATTAAGTAAGATGG + Intergenic
1030506444 7:110430074-110430096 CAGTTCCAAGGTAATTCAATGGG + Intergenic
1047348734 8:124053349-124053371 CAGTGCTTACTTTATTAAGTCGG - Intronic
1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG + Intronic
1052759736 9:32578069-32578091 CAGTGGGAACCTATTTAAGTTGG - Intergenic
1054711866 9:68518811-68518833 AAGTGCTAACATAATTTAGTTGG + Intronic
1056019416 9:82425840-82425862 GAATGCCCACGTAATAAAGTAGG - Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1203626375 Un_KI270750v1:29306-29328 CAGTGCCAAATTAAGTAAGATGG + Intergenic
1186420435 X:9421079-9421101 TAATGGCAACATAATTAAGTGGG - Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1195139690 X:101946968-101946990 CAGAGCCAATATTATTAAGTAGG + Intergenic
1199298028 X:146181351-146181373 CAGTGCAAATGTAATTGAGGAGG + Intergenic
1201675003 Y:16571220-16571242 TAGTGCCAAAGTAAGGAAGTGGG + Intergenic