ID: 1084162030

View in Genome Browser
Species Human (GRCh38)
Location 11:67355266-67355288
Sequence ACCAGGGCTGGGAAGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 662}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084162017_1084162030 16 Left 1084162017 11:67355227-67355249 CCCTGCGGAGTTAGTGATGGAAG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1084162030 11:67355266-67355288 ACCAGGGCTGGGAAGGGCCTAGG 0: 1
1: 0
2: 5
3: 74
4: 662
1084162018_1084162030 15 Left 1084162018 11:67355228-67355250 CCTGCGGAGTTAGTGATGGAAGC 0: 1
1: 0
2: 0
3: 8
4: 48
Right 1084162030 11:67355266-67355288 ACCAGGGCTGGGAAGGGCCTAGG 0: 1
1: 0
2: 5
3: 74
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084162030 Original CRISPR ACCAGGGCTGGGAAGGGCCT AGG Intronic
900113466 1:1019396-1019418 CCCAGAGCTGGGAAGGGGCGTGG + Intergenic
900119086 1:1041000-1041022 AGCGGGGCTGGGAGGGGCCTGGG + Intronic
900119124 1:1041075-1041097 AGCGGGGCTGGGAGGGGCCTGGG + Intronic
900206808 1:1435159-1435181 AGCAGGGATGGGAAGGACCATGG - Intronic
900294361 1:1941466-1941488 AGCAGGCCTGGGAAGAGCCTTGG + Intronic
900312662 1:2041689-2041711 ACCAGGGCGTGGACTGGCCTGGG - Intergenic
900404169 1:2485281-2485303 ATCAGGCCTGGGCAGGGACTGGG + Intronic
900419776 1:2550910-2550932 GCCAGGGCTGGGGAGGGGTTGGG - Intergenic
900425195 1:2575128-2575150 GCCAGGGCTGGGGAGGGGTTGGG + Intergenic
900559200 1:3295337-3295359 GCCAGTGCTGGGAGGGGACTGGG + Intronic
900569935 1:3353251-3353273 ACGAGGGCTGGGCAGCTCCTAGG + Intronic
900690591 1:3978134-3978156 ACCAGGGCTGGAGGGGGACTTGG + Intergenic
900691801 1:3985236-3985258 GCCAGGGATGGGAAGAGGCTGGG - Intergenic
900745898 1:4360616-4360638 AGCAGGGCTGGATGGGGCCTGGG - Intergenic
900872254 1:5312389-5312411 TCCAGGCCTGGGAAGGGGCAGGG - Intergenic
900893653 1:5467722-5467744 ACCAGGGCTGGAAGGTGGCTGGG - Intergenic
901154041 1:7123649-7123671 ACCAGGGCTCAGAGGGGCCAAGG - Intronic
901264392 1:7898990-7899012 AGCATGGCTGGGGAGGCCCTGGG + Intergenic
901401015 1:9015072-9015094 CCCCGGGGTGGGCAGGGCCTGGG + Intronic
901701140 1:11045310-11045332 CCCAGGGGTGCGGAGGGCCTGGG - Intronic
901760091 1:11465352-11465374 AGCAGGTCTGGGAGGGGCCCTGG + Intergenic
902448845 1:16484295-16484317 AGCAGGCCGGGGAGGGGCCTCGG + Intergenic
902505924 1:16939058-16939080 AGCAGGCCGGGGAGGGGCCTCGG - Exonic
902612195 1:17603770-17603792 ACCGGGGCCGGGCAGGGCTTGGG + Intronic
902676942 1:18015385-18015407 TCCAGGGTTGGGAATGGCCTGGG + Intergenic
902847998 1:19127432-19127454 ACCAGAGCTTGGAAGGGATTCGG + Intronic
903145926 1:21371947-21371969 ACCAGGCCTCTGAAGGGCCAGGG + Intergenic
903154913 1:21436725-21436747 AGCAGGCCGGGGAGGGGCCTCGG - Intergenic
903175280 1:21576657-21576679 CCCAGGGCTGGGAGGGGACAGGG + Intronic
903188074 1:21640590-21640612 AGCTGGGCTGGGAAAGGCCAAGG + Intronic
903326876 1:22573868-22573890 AGGAGGGCTGGGAAGGGGCCTGG + Intronic
903403993 1:23081028-23081050 TCCTGGGCTTGGAGGGGCCTGGG + Intronic
903554274 1:24181704-24181726 ACCAGGCCTGGGCTGGGCCTGGG - Intronic
903834983 1:26197908-26197930 GAAGGGGCTGGGAAGGGCCTAGG + Intronic
904119948 1:28191324-28191346 GCCTGGGCAGGGGAGGGCCTGGG + Intronic
904354070 1:29927071-29927093 ACCAGGGCTGGGCAGTGCTGGGG + Intergenic
904492601 1:30870201-30870223 ACCAGGGCTGGGCAGGGCTTAGG - Intronic
905171675 1:36113520-36113542 GCGAGGTCTGGGAAGGGACTTGG + Intronic
905328521 1:37175648-37175670 GCCAGGGCTGGGAAGTGACAGGG - Intergenic
905388725 1:37622708-37622730 ACCAGGGCTGGGAGGAGACAAGG + Intronic
905626964 1:39495583-39495605 CCCAGGGAAGGGAAGGGCCGTGG - Intronic
905669972 1:39785188-39785210 CCCAGGGAAGGGAAGGGCCGTGG + Intronic
905895516 1:41543536-41543558 ACCAGAGAGGGCAAGGGCCTGGG - Intronic
906202220 1:43967500-43967522 AGCAGAGCTGGGGTGGGCCTGGG + Intronic
906381482 1:45334758-45334780 GCCAGGGCTGGGATGGGTCAAGG + Intronic
908138725 1:61160309-61160331 ACCAGGTCTCGGAAGGGGCTAGG - Intronic
909100456 1:71342320-71342342 TGCAGGGGTGGGAAGGACCTTGG - Intergenic
910869350 1:91818450-91818472 ACCAGGGCTGGCAAGGTCCACGG - Intronic
911254445 1:95618083-95618105 GCCAGGTCAGGGAAGGGCCCTGG + Intergenic
912568626 1:110606465-110606487 CCCAGGGCGGGGAGGGGTCTGGG + Intronic
913240618 1:116826396-116826418 ACCAGGGTGTGCAAGGGCCTGGG - Intergenic
913958258 1:143321840-143321862 GCCAGGGCAGGGCAGGGCCAGGG + Intergenic
914052573 1:144147215-144147237 GCCAGGGCAGGGCAGGGCCAGGG + Intergenic
914126624 1:144819326-144819348 GCCAGGGCAGGGCAGGGCCAGGG - Intergenic
914681169 1:149939266-149939288 AGTAGGGGTGGGAAGGACCTTGG - Exonic
914801998 1:150968716-150968738 ACCATTGATGGAAAGGGCCTGGG + Intronic
915106942 1:153540674-153540696 TCCAGGGCTGAGAGGGGGCTGGG + Intronic
915662727 1:157417276-157417298 ACCAGAGCTGGGAAAGGCGGGGG - Intergenic
915916060 1:159941738-159941760 CCCAGGCCTGGGAGGGGTCTCGG - Intronic
916211775 1:162365575-162365597 AGCAGGGCTGGGCAGGGCACTGG - Intronic
916211965 1:162366942-162366964 AGCTGGTCTGGGAAGGGCTTTGG + Intronic
916247751 1:162705596-162705618 GCCAGGGCTGACAGGGGCCTTGG + Intronic
916317589 1:163467515-163467537 ACAAAGGCTGGGAGGGGCTTGGG + Intergenic
917521682 1:175752966-175752988 AATAGTGCTGGGAAGGGCCTTGG - Intergenic
919447871 1:197732133-197732155 ACCAGACTTGGGAAGGTCCTGGG - Intronic
919848440 1:201656137-201656159 GCCAGGGCTCGGCAGGGTCTGGG + Intronic
920051227 1:203166200-203166222 TTCAGGGCTGGGCAGGTCCTGGG + Exonic
920341262 1:205276458-205276480 GACAGGGCTGGGCAGGGCTTGGG + Intergenic
920651197 1:207838655-207838677 ACCAGGGCTGGGAACAGTCAGGG + Intergenic
923511638 1:234658444-234658466 ACTAGGGCTGGGAGGAGCCCAGG + Intergenic
924031477 1:239889717-239889739 ACCTGGGCTGGGATGGGCTGAGG + Intronic
1062768089 10:80541-80563 GCCAGGGCTGGGATGGGCCCAGG + Intergenic
1062886186 10:1018135-1018157 ACCAGGGCTGGGCTGGGCGCAGG + Exonic
1064018995 10:11794327-11794349 CCCAGTGCTGGGAAGGGACAGGG - Intergenic
1064158042 10:12919901-12919923 ACCAGGGATGGGCAGTGACTTGG + Intronic
1064515358 10:16142058-16142080 ACCAGGCCTGGAAGGGGCCCAGG + Intergenic
1064986292 10:21213640-21213662 ACCAGGGCAGGAGAAGGCCTGGG + Intergenic
1064987528 10:21225970-21225992 ACCACGGCTGGGAATGTGCTGGG + Intergenic
1065391919 10:25191453-25191475 ACAAGGTCTAGGCAGGGCCTGGG - Intronic
1065699290 10:28409384-28409406 AACAGAGCTGGGAAGAGCCTAGG + Intergenic
1065844947 10:29736376-29736398 CCCAGGGCTGGGAAGATGCTTGG + Intronic
1066708227 10:38203908-38203930 ACCACAGCTGGGAATGTCCTGGG - Intergenic
1066961257 10:42230330-42230352 GCCAGGGCAGGGCAGGGCCAGGG + Intergenic
1067015886 10:42755958-42755980 GCCAGGGCGGGGTAGGGACTGGG - Intergenic
1067062748 10:43086331-43086353 AACAGGGATGAGAAGGGGCTGGG + Intronic
1067135133 10:43601287-43601309 ACCAAGGCTGGCAAGAGGCTGGG - Intergenic
1067211922 10:44266540-44266562 ACGTGGCCTGGGAAGGGCATGGG + Intergenic
1067381532 10:45778167-45778189 ACCAGGACTGGGATAGGACTGGG - Intronic
1067512675 10:46908872-46908894 AACAGGGCTGGGAAGTCGCTTGG - Intergenic
1067649570 10:48142950-48142972 AACAGGGCTGGGAAGTCGCTTGG + Intergenic
1067710755 10:48649389-48649411 ACCAAGGCTGGGAGCAGCCTGGG - Intronic
1067801260 10:49361025-49361047 ACCAGGGCAGGAGAGGCCCTAGG + Intergenic
1067828789 10:49598065-49598087 GGCAGGGCAGGGCAGGGCCTGGG + Intergenic
1067889231 10:50118801-50118823 ACCAGGACTGGGATAGGACTGGG - Intronic
1068038172 10:51787444-51787466 ACCAGGGATGGGCAGGGACTGGG + Intronic
1068776426 10:60872914-60872936 ACCAGGTCTGGGGAGGGAATGGG - Intronic
1069307004 10:66983248-66983270 AACATGGCTGGGAGGGGGCTAGG - Intronic
1070668990 10:78364910-78364932 TCCAGGGCTGGGTTGAGCCTGGG - Intergenic
1070794117 10:79207141-79207163 GCCAGGGCAGGGAGGGGCCTAGG - Intronic
1070895451 10:79980184-79980206 ACCAGAGCTGGGAATGTGCTGGG - Intronic
1071302342 10:84265384-84265406 ACGAGGGCTGGGAAAGCACTGGG + Intergenic
1073070053 10:100787615-100787637 CCCAACGCTGGGCAGGGCCTCGG + Intronic
1073074344 10:100814420-100814442 AGCAGTGGTGGGAAGGGACTGGG - Intronic
1073097938 10:100991490-100991512 ACGAGGCCTGGGCTGGGCCTAGG + Intronic
1073291737 10:102416614-102416636 CCAAGGGCTGGGGTGGGCCTGGG + Exonic
1073351663 10:102824345-102824367 ACCAGGTCTGGGAGGGGCGGGGG - Intergenic
1074208090 10:111301947-111301969 ACCAGGGAGTGGCAGGGCCTTGG - Intergenic
1074283251 10:112073318-112073340 ACCAGGGCAGGGAAGGGGTATGG - Intergenic
1075591153 10:123692587-123692609 ACCTGGGCTGGGCCGGACCTGGG + Exonic
1075672202 10:124270386-124270408 ACCAGGGATGGGAAGGCCAAGGG - Intergenic
1076048378 10:127313000-127313022 CCCAGGACTGGGAGGGGCCAGGG - Intronic
1076160492 10:128240755-128240777 TTCAGGGCTGGGTGGGGCCTGGG + Intergenic
1076267238 10:129118411-129118433 ACCCAGGGTGGGAAGGGCCTGGG + Intergenic
1076404705 10:130203957-130203979 GTCAGGGCTGGCAAGGGCCTGGG - Intergenic
1076495957 10:130898067-130898089 TTCAGGGCTGAGAGGGGCCTGGG + Intergenic
1076668461 10:132105781-132105803 CCGTGGGCTTGGAAGGGCCTGGG + Intronic
1076900308 10:133334717-133334739 ACGAGGGCTGGGTAGGGGATGGG + Intronic
1076991939 11:279995-280017 AGCAGGGCCGGGGAGGGCGTGGG + Intronic
1076995468 11:295508-295530 ACAAAGGCTGGGCAGGGCCAGGG - Exonic
1077024203 11:432138-432160 GCCAGGACAGGGAGGGGCCTGGG - Intronic
1077052136 11:571656-571678 GGCAGGGGTGGGAAGGGGCTGGG + Intergenic
1077167322 11:1149700-1149722 GCCAGGGCTGGGCAGGGGCTGGG - Intergenic
1077225827 11:1438746-1438768 CCCAGGGCTGGGGACGTCCTGGG - Intronic
1077343826 11:2037434-2037456 GGCAGCTCTGGGAAGGGCCTGGG + Intergenic
1077504619 11:2924320-2924342 CACAGGGCTGGGAGGGGCTTTGG - Intronic
1077543765 11:3160029-3160051 GCCAGGGCAGGGAGGGGGCTGGG - Intronic
1077549835 11:3195262-3195284 ACCAGTGCTGGGAAGGGTCCAGG + Intergenic
1078067384 11:8087328-8087350 CCCAGGGCTGGGGATGGCCCAGG + Intronic
1078447485 11:11415326-11415348 ATCAGGGCTGGGAAGGGTGGGGG + Intronic
1079250044 11:18780560-18780582 ACCTGGGCTGAGGTGGGCCTTGG - Intronic
1080100555 11:28454886-28454908 ACAAGGGATGGGGAGGGGCTTGG + Intergenic
1080233307 11:30042223-30042245 ACCTGGGATGGGAAGGACCTGGG + Intergenic
1082885118 11:58073807-58073829 ACCAGGGCCTGTAAGGGCATGGG - Intronic
1083160389 11:60850686-60850708 TCCAGGCCTGGGATGGACCTAGG - Exonic
1083656140 11:64230625-64230647 GCCAGCGCTGGGAAGGGCTGCGG + Exonic
1083716126 11:64578044-64578066 ACCTGGGAAGGGAAGGGCCTGGG - Intergenic
1083766190 11:64842727-64842749 TCCAGGCCTGGAAAGTGCCTGGG - Intronic
1083778039 11:64903670-64903692 AACAGGGCTGAGAAGGGCCCGGG + Intronic
1084162030 11:67355266-67355288 ACCAGGGCTGGGAAGGGCCTAGG + Intronic
1084323937 11:68388360-68388382 ACCAGGGCTAGGAGGGGCCTTGG - Intronic
1084392939 11:68890559-68890581 ACCAGCAAAGGGAAGGGCCTGGG - Intergenic
1084473906 11:69378096-69378118 CCCAGGGCTGGGACCTGCCTGGG + Intergenic
1084502094 11:69540840-69540862 ACCAGGGCAGGGATTGGCTTGGG - Intergenic
1084580750 11:70021704-70021726 CCCAAGGCTGGGCAAGGCCTCGG + Intergenic
1084586911 11:70067715-70067737 GGGAAGGCTGGGAAGGGCCTTGG - Intergenic
1085126703 11:74006987-74007009 ACCATGGCTGTGAAGTTCCTGGG - Exonic
1085178433 11:74511178-74511200 ACCACAGCTGGGAAGGTGCTGGG - Intronic
1085643583 11:78208650-78208672 AGCAGGGCTGAGCAGGGCATTGG - Intronic
1086903633 11:92395044-92395066 AACTGGGCTGGAAAGGACCTTGG - Intronic
1087282683 11:96229408-96229430 TCCAGGGGTGTGAAAGGCCTTGG - Intronic
1088707320 11:112475575-112475597 ATCAGTGCTAGGAAGGCCCTGGG - Intergenic
1089619623 11:119714742-119714764 AACAGGGGTGGGAAGGGGGTGGG + Intronic
1090188623 11:124753832-124753854 ACCAGGCCTGGGAGGGCCATGGG + Exonic
1090444824 11:126755231-126755253 AGGAGGGCAGGCAAGGGCCTCGG - Intronic
1090976397 11:131683855-131683877 ACCAGGGCTGGGAAGACCCCGGG - Intronic
1090984125 11:131750830-131750852 ACAAGGCCTGGGAAGCGCTTAGG - Intronic
1091282756 11:134391335-134391357 GCCTGGGCTGGGCAGGGGCTTGG + Exonic
1091358885 11:134958574-134958596 CCGAGGGCTGGGATGGGGCTAGG + Intergenic
1202826812 11_KI270721v1_random:92623-92645 GGCAGCTCTGGGAAGGGCCTGGG + Intergenic
1091448937 12:560863-560885 AAAAGGCCTGGGGAGGGCCTAGG + Intronic
1091972760 12:4801753-4801775 ACCAGGACTGGGTAGGACTTTGG + Intronic
1095830576 12:46582016-46582038 ACCAGGGCTGGTCAGGGGGTGGG - Intergenic
1096227020 12:49872564-49872586 ACCAGGGCTGGGATTCGACTAGG - Intronic
1096680482 12:53252304-53252326 GGCAGGGCTGGGCAGGGGCTAGG + Intronic
1098741699 12:74180112-74180134 GGCAGGGCTGGGAAGGCCTTAGG + Intergenic
1099294953 12:80818673-80818695 GGCAAGGCTGGGAAGAGCCTAGG - Intronic
1102013084 12:109631002-109631024 ACCAGGTGTGGGACGGGCCCTGG + Intergenic
1102028151 12:109725151-109725173 CCCAGAGCTGGGAAGGAGCTTGG + Intronic
1102218532 12:111178945-111178967 AGCAGGGCTGAGAGAGGCCTGGG + Intronic
1102346290 12:112163311-112163333 CCCAGGGCTGGGGAGGCACTGGG - Intronic
1102567203 12:113804541-113804563 ACCATGCCTGGCCAGGGCCTGGG + Intergenic
1102575393 12:113853138-113853160 CCCCAGGCTGGGGAGGGCCTGGG + Intronic
1103018190 12:117512491-117512513 AGTAGGTCTGGGAGGGGCCTGGG - Intronic
1103962537 12:124617939-124617961 ACGAGGGCTGAGGAGGGCCCCGG - Intergenic
1104499602 12:129272236-129272258 AGCAGGTCTGGGGTGGGCCTAGG - Intronic
1104623157 12:130333321-130333343 AGCAGGCCTGGGCAGGGCCTGGG + Intergenic
1104873491 12:132017018-132017040 ACCAGGGCTGGGCAGGAAATGGG - Intronic
1104967484 12:132514736-132514758 AGCAGGGGTGGGTAGGGCCCTGG + Intronic
1105068102 12:133217359-133217381 CCCAGGGATGGGATGGGCCCAGG + Intergenic
1105208018 13:18239245-18239267 ACCAGGGCCGGGGGAGGCCTTGG + Intergenic
1106035571 13:26041612-26041634 AGTAGGGCTGGCAAGTGCCTGGG + Intergenic
1108500034 13:51061352-51061374 ACCAGGCCTGTGCAGGGCCATGG + Intergenic
1112098444 13:96160856-96160878 CACAGGGCTGGGATGGCCCTGGG + Intronic
1112435440 13:99388586-99388608 ACTACTGCTGGGAAGGGCCTGGG + Intergenic
1113572791 13:111370721-111370743 CCCAGGGCTGGGAAGGACGTGGG - Intergenic
1113613947 13:111668345-111668367 ACAGGGGCTGGGAAGTCCCTTGG + Intronic
1113733521 13:112658989-112659011 AAGAGGCCTGGGAAGGGTCTGGG - Intronic
1113826248 13:113256294-113256316 ACCAGGGCTGGCAGTGCCCTCGG + Intronic
1113966678 13:114156463-114156485 ACCAGGACTGGGAAGGGCGAGGG - Intergenic
1114092689 14:19303181-19303203 GCCAGGGTTGGGTAGGGACTGGG - Intergenic
1114385931 14:22254614-22254636 ACCAGGCCTGGGTAGGTCCCAGG - Intergenic
1114581551 14:23764993-23765015 ACTTGAGCTGGGAAGGGCCATGG - Intergenic
1114657359 14:24324109-24324131 ACCAGGACTGAGAATAGCCTTGG - Exonic
1116867061 14:50039801-50039823 GCCATGGCAGGGCAGGGCCTAGG - Intergenic
1117333638 14:54738050-54738072 ACAAGGGCTGGGAAGCCCTTAGG + Intronic
1117409883 14:55440740-55440762 CCCGCAGCTGGGAAGGGCCTGGG + Intronic
1118367608 14:65109124-65109146 ACAAGGGGTGTGAAAGGCCTGGG - Intergenic
1118592778 14:67413565-67413587 TCCAGGGCAGGGACTGGCCTGGG - Intergenic
1118594379 14:67424628-67424650 ACTAGGGGTGGGCAGGGGCTTGG - Intergenic
1118719304 14:68582986-68583008 ACCAGGGCCTGTAAGGGGCTAGG + Intronic
1118838855 14:69496222-69496244 GCCAGGGCTGGGAAGTGGGTGGG - Intronic
1119420793 14:74506644-74506666 GCCAGGGAAGGGAAGGCCCTGGG - Intronic
1119467863 14:74873505-74873527 TCCAGAGCTGGAAAGGGCTTAGG + Intergenic
1119474851 14:74921248-74921270 ACCGGGGCTGGGCAGGGCTGGGG - Intronic
1119720119 14:76884740-76884762 ACCAGGGCTGGAGAGGATCTGGG + Intergenic
1119787986 14:77327080-77327102 AGGAGGCCTGGGAAGGGCCCAGG + Intronic
1119963256 14:78883100-78883122 ACCAGGGCTGGAAAGGCCTCAGG - Intronic
1120340687 14:83217255-83217277 ACCATGGCTGGGAATGTTCTGGG + Intergenic
1120996778 14:90423538-90423560 GCCAGGGCAGGGAACGGCCAGGG - Intergenic
1121352419 14:93184485-93184507 ACCAGGGCTGGGAGGGGTGAGGG - Intronic
1121456840 14:94043775-94043797 ACCAGGGCCCGGCAGGGCCAGGG + Intronic
1121600639 14:95200456-95200478 GCCAGGGAGGAGAAGGGCCTGGG - Intronic
1122264688 14:100541096-100541118 TGCAGGGCTGGGCAGGGACTGGG + Intronic
1122373127 14:101240289-101240311 CCAAGAGCTGGGAAGGACCTTGG + Intergenic
1122485247 14:102075305-102075327 CCAAGAGCTGGGCAGGGCCTGGG - Intergenic
1122871601 14:104641289-104641311 ACCAGGGCTGTGCTGGGGCTGGG + Intergenic
1123035993 14:105472158-105472180 ACCGGTGCTGGGTGGGGCCTGGG + Intergenic
1124006152 15:25797124-25797146 ACCAGAGGTTGGAAGGGACTTGG - Intronic
1126532963 15:49731444-49731466 ACCAGTGATGGGAAGGGGTTGGG - Intergenic
1126778246 15:52117946-52117968 TCCAGGCTTGGGAATGGCCTGGG + Exonic
1128940664 15:71785139-71785161 ACCAGGGCAGGGATGTGACTGGG + Intergenic
1128943550 15:71807223-71807245 TTCAGGGATGGGAAGGGTCTGGG + Intronic
1129198069 15:73982796-73982818 AGCAGGGCTGGGCTGGGCCTGGG + Exonic
1129249220 15:74299397-74299419 ACCAGGCCTGGGCAGGGCTCTGG - Intronic
1129275042 15:74439728-74439750 ATCAGAGCTGGGAGGGTCCTGGG - Intergenic
1129645849 15:77431793-77431815 ACCAGGGGTGGGGTGGGGCTGGG - Intronic
1129790553 15:78338170-78338192 GGCAGGGCTGGGGAGGGACTGGG - Intergenic
1130274339 15:82468729-82468751 AGCAGTGCTGGGATGGGCCCAGG - Intergenic
1130466685 15:84196103-84196125 AGCAGTGCTGGGATGGGCCCAGG - Intergenic
1130497579 15:84477433-84477455 AGCAGTGCTGGGATGGGCCCAGG + Intergenic
1130588981 15:85200696-85200718 AGCAGTGCTGGGATGGGCCCAGG - Intergenic
1130649014 15:85751620-85751642 AGCGGGGGTGGGAAGGGCCCAGG - Intergenic
1130915676 15:88302769-88302791 ACCAGGGGTGGGATGGGAGTTGG - Intergenic
1131805206 15:96114852-96114874 ATCAGGGCAGGGCAGGGGCTAGG + Intergenic
1131829423 15:96344739-96344761 ACCAGCGGTGGGAAGGGGCACGG - Intergenic
1132029756 15:98430135-98430157 CCCAGGACTGGGAAGAGCTTGGG - Intergenic
1132589688 16:721226-721248 ACCCGAGCCGGGAAGGACCTTGG + Exonic
1132803768 16:1766448-1766470 TGCAGAGGTGGGAAGGGCCTCGG + Intronic
1132888656 16:2193877-2193899 CCCAGAACTGAGAAGGGCCTGGG + Intronic
1133002541 16:2858445-2858467 TTCCGGGCTGGGGAGGGCCTGGG + Intergenic
1133027656 16:2995660-2995682 AGCAGGGGTGGGGAGGGGCTGGG + Intergenic
1133241225 16:4415857-4415879 GCCACGGCTGGGTGGGGCCTGGG - Intronic
1133292643 16:4733075-4733097 ACCAAGGCTGGGAAGGGTAGTGG + Intronic
1133472714 16:6091214-6091236 ACTAAGGCTGGGAAGGGTGTGGG - Intronic
1134143348 16:11741526-11741548 ACCAGCGCTGGGAAGATCCCGGG - Intronic
1134802672 16:17099885-17099907 ACCAAAGCTGTGAAGGGCCTGGG + Intergenic
1135472864 16:22747385-22747407 AACAGGTCTGGGATGGACCTTGG - Intergenic
1135764622 16:25166746-25166768 ACCTGGGCAGGAAAGGACCTGGG - Intronic
1136020858 16:27438891-27438913 GGCAGGGCATGGAAGGGCCTGGG + Intronic
1136417695 16:30113697-30113719 CTGGGGGCTGGGAAGGGCCTGGG - Exonic
1136623158 16:31443224-31443246 AGCGGGGCTGGGAAGCGCCATGG + Intergenic
1136861262 16:33705678-33705700 ACCAGAGCTGGAGAGGGTCTTGG + Intergenic
1136862924 16:33713570-33713592 ACCAGGGCTGGGATAGGGCCAGG - Intergenic
1137589975 16:49687438-49687460 ATCAGGGCTGGGCAGAGGCTGGG - Intronic
1138201521 16:55091885-55091907 AACGGGGCTGGGCAGCGCCTAGG + Intergenic
1138515015 16:57531119-57531141 ACCTGGGCTGGAGAGGGACTTGG - Intronic
1138589568 16:57992394-57992416 ACCAGGGGTGGGAAGGGGAGGGG - Intergenic
1139577018 16:67847891-67847913 ACCTGGGCTGGAAGGGGCTTTGG + Intronic
1139751600 16:69112296-69112318 TCCATGCCTGGGAAGGGCCCAGG - Intronic
1140975538 16:80056620-80056642 ATAAGAGCTGGGAAGGGGCTGGG + Intergenic
1141298316 16:82790671-82790693 ACCATGGCTGGGAAGGCCTCAGG + Intronic
1141378254 16:83551476-83551498 CCCAAGGCTGGGAAGGTACTAGG - Intronic
1141408912 16:83818970-83818992 AGTAGGGCTAGGTAGGGCCTGGG - Exonic
1142287903 16:89178935-89178957 GCCAGGGCTGGGGAGAGCGTGGG - Intronic
1142319180 16:89370165-89370187 TCCAGGGCAGGGAGGGGCGTGGG - Intronic
1203122759 16_KI270728v1_random:1553869-1553891 ACCAGAGCTGGAGAGGGTCTTGG + Intergenic
1203124402 16_KI270728v1_random:1561717-1561739 ACCAGGGCTGGGATAGGGCCAGG - Intergenic
1142602229 17:1059266-1059288 AACAGGGCAGGGAAAGGGCTTGG - Intronic
1142752255 17:1996035-1996057 GCCAGGGCAGGGCAGGGCCCAGG - Intronic
1142839084 17:2613284-2613306 ACAGAGGCTGGGAAGGGTCTGGG + Intronic
1143104641 17:4522835-4522857 GCCAGTGATGGGAGGGGCCTTGG - Intronic
1143129664 17:4669905-4669927 ATCTGGGATGGGAAGGGCCACGG + Intergenic
1143500612 17:7336601-7336623 ACCTCCGCGGGGAAGGGCCTGGG - Exonic
1143747855 17:9006452-9006474 CCCAGTGCAGGGAGGGGCCTTGG + Intergenic
1143868778 17:9943092-9943114 CCCAGGGCTGGGAGGGGCCCAGG + Intronic
1144220938 17:13099305-13099327 ACCAGGGCTCTGGAGGGACTCGG + Intergenic
1144598716 17:16594209-16594231 ACCAGAGCTGGGAAGGGTAGAGG + Intergenic
1144672197 17:17139143-17139165 ACAAGGGCAGGGCAGGGCATGGG - Intronic
1145231689 17:21177738-21177760 ATCAGATCTGGGAAGGGCCTCGG + Intronic
1145279553 17:21457729-21457751 CCCAGGGCAGGGATGGGCCATGG + Intergenic
1145836192 17:27956042-27956064 ACCAGCACTTGGAAGGGCCCTGG - Intergenic
1145974142 17:28974710-28974732 CCCAGTTCTGGGGAGGGCCTGGG - Intronic
1146283890 17:31561488-31561510 CCCAGGGCTGGGAGAGGCATTGG - Intergenic
1146478267 17:33180617-33180639 ACCAGGCCTTGGCAGGGACTTGG + Intronic
1146950161 17:36900096-36900118 ACAAGGGCTGGGAAAGACCAGGG + Intergenic
1147746695 17:42699109-42699131 AACAGGGATGAGAAGGGCATTGG - Exonic
1148111134 17:45145038-45145060 CCCAGGGGTAGGAAGGTCCTAGG - Intergenic
1148779421 17:50113080-50113102 GCCAGGACTGGGAAGGTTCTGGG - Intronic
1149167972 17:53776432-53776454 ACCAGGGGTGAGATGGGCATGGG - Intergenic
1149402962 17:56317670-56317692 ACCATGGCTGGGATGGGGCTTGG + Intronic
1149415676 17:56457511-56457533 ACCAGGGCTGAAAAGGACCTTGG - Intronic
1149524193 17:57341144-57341166 ACCAGGGCTGGGGTGGGCCAGGG + Intronic
1150158783 17:62876201-62876223 GCCCAGGCTGTGAAGGGCCTGGG - Intergenic
1150390515 17:64787419-64787441 GCCTGGGCGGGGCAGGGCCTAGG + Intergenic
1151496428 17:74460795-74460817 ACCAGGGATGGGTAGGGGGTGGG + Intergenic
1151714016 17:75822410-75822432 GGCAGGGCTGGCCAGGGCCTGGG + Intronic
1151919004 17:77140355-77140377 CCCAGGGCTCGGGAGGGCCCGGG - Intronic
1152037368 17:77881486-77881508 GCATGGGCTGAGAAGGGCCTGGG + Intergenic
1152057317 17:78040025-78040047 ACCAGGGCTGGGAGGCACCCTGG - Intronic
1152221682 17:79072197-79072219 GGAAGGGCTGGGAGGGGCCTAGG - Intergenic
1152290861 17:79439267-79439289 AGGAGGGCTGGGGAGGGGCTGGG - Intronic
1152343439 17:79737749-79737771 AGCAGGGCTATGAAGGGCCGTGG + Intronic
1152598522 17:81249841-81249863 AGCAGGGCTGAGAAGGACCACGG + Intronic
1152634227 17:81423866-81423888 AGCTGGGCTGGGCGGGGCCTGGG + Intronic
1152750084 17:82058599-82058621 TCCAGGCCTGGGCAGGGGCTTGG + Intronic
1152811004 17:82382876-82382898 GCCAGGGAAGGGCAGGGCCTGGG - Intergenic
1152903447 17:82958052-82958074 GGCGGGGCTGGGAAGGGCCCGGG - Intronic
1154175790 18:12086813-12086835 GCCAGGGCAGGGACGGGCCAAGG - Intergenic
1154230635 18:12553134-12553156 ACCACAGCGGGGAAGGGGCTGGG - Intronic
1155152740 18:23135656-23135678 ACCCGGGCTGGGTAGGGCGCGGG - Intronic
1155170057 18:23260529-23260551 GCCAGGGCTGGGGAGGGCAAGGG - Intronic
1157863929 18:51165078-51165100 GAGAGGCCTGGGAAGGGCCTGGG + Intergenic
1158500102 18:57993363-57993385 TCCAGGGCTGGGAAGGAAATGGG + Intergenic
1159497216 18:69222245-69222267 ACCAGCCCTGCCAAGGGCCTTGG + Intergenic
1159960923 18:74555358-74555380 GCGAGGGCTGGGAAGGGCCAAGG - Intronic
1160040015 18:75336969-75336991 GCCAGGCCTGGGAATGGCTTGGG + Intergenic
1160204443 18:76822071-76822093 CCTAGTGCTGCGAAGGGCCTCGG - Exonic
1160703371 19:518393-518415 GCCCGGGCTGGGTAGGGGCTGGG + Intronic
1160703433 19:518547-518569 GCCTGGGCTGGGAGGGGACTGGG + Intronic
1160716711 19:580043-580065 ACTGGGGCTGGGACGGCCCTGGG + Intronic
1160741186 19:686841-686863 GTCAGGGCCAGGAAGGGCCTTGG - Intronic
1160909878 19:1469486-1469508 GCCAGGGCTGGGTCGGGCCGCGG - Exonic
1161070770 19:2259387-2259409 GCCGGGGCTGGGAAGGGGATGGG + Intronic
1161085935 19:2334872-2334894 ACCAGGGTTGGGGAGGCCCAGGG - Intronic
1161091221 19:2360993-2361015 AACAGGGATGGGGAGGGCTTCGG - Intergenic
1161566235 19:5004403-5004425 GCAAGGGCTGAGAAGGGCCAAGG - Intronic
1161793316 19:6373399-6373421 ACCAGTGCTGGGATGGGGCGTGG + Intronic
1162059121 19:8084090-8084112 AACAGGACTGGGGAGGGCCGCGG - Intronic
1162477455 19:10909030-10909052 CACAGGGCTGGCCAGGGCCTTGG + Intronic
1162797136 19:13092745-13092767 CCCGGGGGTGGGAAGCGCCTGGG - Intronic
1162885233 19:13692084-13692106 ACCAGGGCTTGGCAGTGCCCTGG - Intergenic
1162927679 19:13938349-13938371 CCCAGGGCGGGGAAGGGGGTGGG - Exonic
1163034935 19:14564754-14564776 AGCAGGGCAGGGATGGGACTTGG - Intronic
1163164165 19:15483887-15483909 ATCAGGGCTGGGCTGGGCCTGGG + Intronic
1163374374 19:16921434-16921456 ACCAGGGCAGGGAGGGCCCCTGG - Intronic
1163584859 19:18157952-18157974 GCCAGGGCTGGGAGGGGGCTGGG + Intronic
1163665909 19:18604072-18604094 AGAAGGGCTGAGAGGGGCCTGGG - Intronic
1163695413 19:18761138-18761160 ACCAGGGCAGGGCAGGGCAGGGG - Intronic
1163720207 19:18895163-18895185 ACCAGGGATGGCAAGGGCCTGGG - Intronic
1164245290 19:23422875-23422897 ACCAGGGGTGGGAAGCACATAGG - Intergenic
1164682741 19:30146330-30146352 GCCAGGGCGGGGCAGGGGCTGGG + Intergenic
1164726422 19:30468743-30468765 AGCAGCGCTTGGGAGGGCCTGGG + Intronic
1164921522 19:32092066-32092088 GGCAGGGCTGGGGAGGACCTGGG + Intergenic
1165173837 19:33912890-33912912 AGCATGGCTGGGAAGGCCTTGGG + Intergenic
1165309871 19:35023394-35023416 GCCAGGCCTGAGCAGGGCCTTGG - Intronic
1165485093 19:36090628-36090650 ACCAGGCCTGAGAAGGTGCTGGG - Intronic
1165487600 19:36104892-36104914 TCCTGGGCTGGGCAGAGCCTGGG - Exonic
1165777092 19:38411076-38411098 ACCGGTGCTGGGAAGGGGCCTGG - Intronic
1166382345 19:42361706-42361728 GACAGGGCAGGGACGGGCCTGGG + Intronic
1166534385 19:43563133-43563155 CCCAGGGCTGGGAATGGCGGTGG - Intronic
1166763383 19:45238457-45238479 ACCAGGGCTGGGGATGGACATGG + Intronic
1166918713 19:46213690-46213712 ACCAGGGCTCGGTATGGCTTTGG - Intergenic
1167036550 19:46998468-46998490 ACCTTGACTGGGAAGGGCATCGG - Intronic
1167166412 19:47802768-47802790 ACCAGGCCTGGGGTGGCCCTGGG - Exonic
1167253023 19:48410977-48410999 CCCAGGGCTGGGGATGGCCGGGG - Intronic
1167269504 19:48499273-48499295 GACTGGGCTGGGAAGGGCCGGGG + Exonic
1167698334 19:51027620-51027642 AGCAAGGCAGGGGAGGGCCTAGG + Exonic
1168019194 19:53596268-53596290 ACCAGGGCTGCGGTGGGACTTGG - Intergenic
1168404025 19:56101418-56101440 GCCAGGGCTGGGCAGGGCAGCGG + Intronic
1168426276 19:56241728-56241750 ACCAGGGCTGGGATGGGGGTTGG - Intronic
1168520369 19:57045349-57045371 AGCAGGTCTGGCATGGGCCTGGG - Intergenic
1168592288 19:57647272-57647294 TCCAGGGCTGCCAAGGGCCCAGG - Intergenic
1202691971 1_KI270712v1_random:99639-99661 GCCAGGGCAGGGCAGGGCCAGGG + Intergenic
925061739 2:896906-896928 TGCAGGGTTGGGGAGGGCCTTGG - Intergenic
925114255 2:1365196-1365218 ACAAGGGCTGGGCAGGCCCTGGG + Intronic
925174076 2:1770163-1770185 GCCAGGGCTGGGAATGGCTGAGG + Intergenic
925734177 2:6945903-6945925 AGCAGGGCTGGGGAGCCCCTTGG + Intronic
925899196 2:8496292-8496314 GCCCGGGCTGTGCAGGGCCTTGG - Intergenic
926088967 2:10037821-10037843 AGTAGGGATGGGAAGGGCCGAGG + Intergenic
926327971 2:11801587-11801609 ACCAGAGCTGGGAAGGGTAGAGG + Intronic
926337776 2:11877131-11877153 AGCAGGTCTGGGAAGGGGCTGGG - Intergenic
926357683 2:12056375-12056397 ACCTGAGCAGGGAAGGGTCTGGG + Intergenic
927808863 2:26171032-26171054 GCCAGGCTGGGGAAGGGCCTCGG + Intergenic
927958277 2:27223572-27223594 AGCAGGGCTGGTTATGGCCTCGG - Exonic
929128294 2:38540846-38540868 ACCAGGGCTGGGGAATGGCTGGG + Intergenic
929675184 2:43919531-43919553 ACAAGGGCTGGGAAGGAAATAGG + Intronic
931085162 2:58822099-58822121 ACCAGAGTTGGGAAGGGCAGTGG - Intergenic
931212617 2:60212309-60212331 CCCAGAGATGGGAAGGGCCTGGG + Intergenic
931528595 2:63186565-63186587 CCCAGGGCTTAGAAGGGCCGAGG + Intronic
932111596 2:69006669-69006691 ACCAGGGCACAGAAGGGCTTGGG - Intergenic
932966384 2:76480262-76480284 ACCTGGGCTGGGAAGGCAATAGG - Intergenic
934656320 2:96118275-96118297 CTCTGGGCTGGGCAGGGCCTGGG + Intergenic
935714272 2:105926265-105926287 ACCAGAGATGGAAATGGCCTTGG + Intergenic
935950392 2:108323576-108323598 ACCAGGTCTGAGAGGGGCCAGGG + Intergenic
936028821 2:109054806-109054828 GCCAGGGCAGGGAAGGGACAAGG - Intergenic
936582634 2:113716738-113716760 AGCAGGGCAGGGAAGGGCAGGGG + Intronic
937237005 2:120437116-120437138 GGCAGGGCTGGGATGAGCCTGGG + Intergenic
937315698 2:120930829-120930851 CCCTGGGCTGGGAAGGGGCCTGG + Intronic
937622276 2:124002348-124002370 AGCACAGCTGGGAAGGGCTTAGG + Intergenic
938417317 2:131114409-131114431 TCCAGGGCAGGGATGGGCCATGG - Intronic
938662980 2:133506413-133506435 ACCAGGGCAGGGAAGGGTGAAGG - Intronic
940484291 2:154276932-154276954 AGCATGGCTGGGAAGGCCTTAGG - Intronic
941028008 2:160479624-160479646 GCCAGAGCTGGGGAGGGTCTGGG - Intronic
942880068 2:180848971-180848993 ACCAAGCCGGTGAAGGGCCTGGG + Intergenic
943390931 2:187267140-187267162 TGCATGGCTGGCAAGGGCCTCGG - Intergenic
943437696 2:187886396-187886418 TCCATGGCTGAAAAGGGCCTAGG - Intergenic
944320757 2:198339316-198339338 AGCAGAGCTCGGAAGGGCCGTGG + Intronic
945102655 2:206275407-206275429 CCCGAGGCTGGGAAAGGCCTAGG - Intronic
945694116 2:213081126-213081148 ACCAGGCCTGGGAAGAGTATAGG + Intronic
946064386 2:216974257-216974279 AGCAGGGCTGGAAAGAACCTGGG - Intergenic
946311853 2:218886501-218886523 CCAACGGCTGGGAAGGGGCTGGG - Intronic
946403904 2:219483019-219483041 CCCAGGGCTGAGGTGGGCCTGGG + Intronic
946708742 2:222485441-222485463 AGCAGGGCGGAGAAGGGCTTTGG + Intronic
948492477 2:238322009-238322031 ACCAGGGCTGGCGAGGCCCTGGG - Intronic
948554486 2:238797906-238797928 GGGAGGGCTGGGAAGGACCTTGG + Intergenic
949048658 2:241885155-241885177 ACCAGGGCTGGGGTTGGCCTGGG - Intergenic
1169488737 20:6054109-6054131 GCCAGGCCTGGAAAGGGCCAGGG - Intergenic
1169988728 20:11474939-11474961 ACCACAGCTGGGAATGCCCTGGG - Intergenic
1170131248 20:13022589-13022611 ACCTGGGCTGGGAAGGCCAAAGG + Intronic
1170850029 20:19996442-19996464 CCCAGGCCTGGGAGGGGCCAAGG - Intronic
1171010395 20:21506179-21506201 ACCGGGGCTGGGACGGGCGGTGG + Intergenic
1171244558 20:23601065-23601087 ACTAGGTCTGGGCAGGGCCAGGG - Intergenic
1171347988 20:24480176-24480198 ACCAGTGCTGGGATGGGCCCAGG - Intronic
1171432404 20:25091344-25091366 AGCAGGGCTGGGGCTGGCCTGGG + Intergenic
1171986559 20:31665203-31665225 GCCAGGGAGGGGAAGGGACTAGG + Exonic
1172010312 20:31842561-31842583 ACCCAGGCTGGGAAGGGACTGGG + Intergenic
1172015498 20:31870461-31870483 GGCAGGGCTGGGCAGGGCCGCGG - Exonic
1172088022 20:32404168-32404190 ACCAGAGCTGGGAAGGGGGCAGG - Intronic
1172249014 20:33465834-33465856 CCCAGGGGTGGTCAGGGCCTAGG - Intergenic
1172860557 20:38046813-38046835 AGCTGGGTTGGGAAAGGCCTTGG + Intronic
1173223278 20:41146449-41146471 ACAAAGGCTGTGAGGGGCCTGGG + Intronic
1173671105 20:44799463-44799485 GCCAGGGCTTGGATGGGCCCCGG + Intronic
1174387206 20:50194230-50194252 CCCAGGGCTGGGAGGGGACGTGG - Intergenic
1175778499 20:61667612-61667634 CCCAGGACTGGGTAGGGCCTGGG + Intronic
1175806187 20:61830486-61830508 ACCTGGGCTGGCCAGGTCCTGGG - Intronic
1175985906 20:62764058-62764080 AGCAGGGCTGGGAGGGGTCTGGG + Intergenic
1176028969 20:63001509-63001531 CCCAGGGGTGGGAAAGTCCTTGG + Intergenic
1176140614 20:63543181-63543203 CCCAGGCCTGGGCAGGGCCCTGG + Intronic
1176169968 20:63692321-63692343 GCCTGGGCTGGCGAGGGCCTGGG + Intronic
1176238226 20:64063986-64064008 ACAAGGGCTGGGAAGAGGCAGGG - Intronic
1176267002 20:64214897-64214919 AGCAGACCAGGGAAGGGCCTGGG - Intronic
1176423500 21:6533794-6533816 CCCAGGGCTGAGCAGGTCCTGGG - Intergenic
1176860705 21:14010174-14010196 CCCTGGGCTGGGCAGGGTCTGGG + Intergenic
1177149077 21:17436543-17436565 ACCAGAGGAGAGAAGGGCCTGGG + Intergenic
1178210305 21:30523535-30523557 CCCAGGGCTGGGGAGGCCCTAGG + Intergenic
1178913181 21:36692911-36692933 ACCAGGGCTGGGACCCGCGTGGG - Intergenic
1179096001 21:38314776-38314798 ACCAGAGTGGGCAAGGGCCTGGG - Intergenic
1179492129 21:41747410-41747432 ACCCTGACTGGGAAGGGCCCAGG + Intronic
1179698994 21:43142110-43142132 CCCAGGGCTGAGCAGGTCCTGGG - Intergenic
1180135886 21:45861424-45861446 ACCCAGGCTGGCAAGGGCCCAGG - Intronic
1180488040 22:15819385-15819407 GCCAGGGTTGGGTAGGGACTGGG + Intergenic
1180922326 22:19527345-19527367 CCCAGAGGTGGGAAGGGGCTCGG + Exonic
1181162695 22:20967382-20967404 ACCAAGGATGAGAAGGGCTTTGG + Intronic
1181310353 22:21941335-21941357 ACCTGGGCTGGGCAGGGCCATGG + Intronic
1181354353 22:22289557-22289579 ACCAGGGCAGGGCAAGGCCAGGG + Intergenic
1181381463 22:22508246-22508268 TCCAGAACTGGGGAGGGCCTGGG + Intronic
1181438722 22:22924871-22924893 ACCAGGGATAGGGAGGGCTTGGG - Intergenic
1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG + Intronic
1181860273 22:25812764-25812786 CCAAGGGCTGGAAAGGGACTTGG + Intronic
1182017045 22:27049433-27049455 ACTAGGGCTGAGAAGGGATTAGG - Intergenic
1182532074 22:30968643-30968665 CCGAGGCCCGGGAAGGGCCTGGG - Intergenic
1183095320 22:35548573-35548595 AGCAGGGCTGGGAGTGGCATGGG - Intronic
1183227575 22:36561097-36561119 GCCATGGCTGAGAAGGGGCTAGG - Intergenic
1183499998 22:38173162-38173184 AGCTGTGCTGGGAAGAGCCTAGG - Intronic
1183513054 22:38247059-38247081 ATGTGGGCTGGGACGGGCCTTGG - Intronic
1183654627 22:39177411-39177433 CCCAGGACTGGGCAGGGGCTTGG - Intergenic
1183736706 22:39648493-39648515 GCCGGCGCTGGGAAGGGCTTTGG + Intronic
1183742599 22:39677267-39677289 ACCAGGCCTGGGAAGGGTGGAGG - Intronic
1184214989 22:43060628-43060650 TCCTGGGCTGGGATGGGGCTGGG + Intronic
1184231415 22:43160176-43160198 ACCCTGGCTGGGCAGGGCCTGGG - Intronic
1184586655 22:45452583-45452605 ACCTGTGCTGGGCAGGGCCCAGG + Intergenic
1184655097 22:45937096-45937118 CTCAGTGCTGGGAAGGCCCTTGG + Intronic
1184658481 22:45954241-45954263 GCCAGGGCTGGGAAGGGGAACGG + Intronic
1184720293 22:46308741-46308763 ACCAGAGCTGGGCAGGGCCGGGG - Exonic
1184861997 22:47177525-47177547 ACTGGGGCTGGGAAGGCCCCAGG - Intergenic
1184879722 22:47297237-47297259 ACCAGGGCTGGGTGGGGGCGGGG - Intergenic
1184932958 22:47694988-47695010 ACCAGGGCTGGGGTGGGGGTTGG + Intergenic
1184994368 22:48194534-48194556 TCCAGTGCTGGGAGAGGCCTTGG - Intergenic
1185011720 22:48318355-48318377 CCGAGGGCTGGGGAGGGCGTGGG - Intergenic
1185070783 22:48654561-48654583 ACGAGGGATGGGACGTGCCTGGG - Intronic
1185281959 22:49976033-49976055 GCCAGGGCGGGGACAGGCCTTGG + Intergenic
1185323129 22:50211012-50211034 GCCAGGGCTGGGGTGGGCCCAGG - Intronic
949168562 3:970719-970741 AACAGAGCTAGGAAAGGCCTGGG - Intergenic
949919513 3:8990262-8990284 TCCAGGGCTGGAGAGGGCATTGG - Intronic
950431658 3:12954419-12954441 CCCAGGGCTGGGAGAGGCCCTGG + Intronic
950614434 3:14147794-14147816 GAGAGGGCTGGGAAGAGCCTGGG + Intronic
950758948 3:15203299-15203321 AGTAGGGTTGGGCAGGGCCTGGG - Intergenic
952644361 3:35638730-35638752 ACCTGGGCAGGGTAGGACCTGGG - Intergenic
952812978 3:37421824-37421846 ACCTGTGTTGGGAGGGGCCTTGG + Intronic
952953299 3:38541669-38541691 ATCAGGGCTGGGTAAGGGCTGGG + Intronic
953221166 3:40973134-40973156 TCCAGAACTGGGAAGAGCCTAGG + Intergenic
953907802 3:46877050-46877072 CCCTGGGCCTGGAAGGGCCTGGG + Intronic
954128904 3:48549708-48549730 ATCAGGGCTGGGCAAGGCCAGGG + Intronic
954622719 3:52005152-52005174 ACCAGGGCTGAGGAGTGCCTGGG - Intergenic
954646398 3:52134185-52134207 ACCAGGGCTGGGATGGGGAAGGG + Intronic
955670315 3:61394898-61394920 TCCAGGCTTGGGAAGGGCCTCGG - Intergenic
956157824 3:66317411-66317433 TCCAGGGATGGGAGGGGCCCCGG - Intronic
956210314 3:66795669-66795691 CCCAGGGCAGGGCAGGGCATCGG - Intergenic
956441907 3:69288800-69288822 ACCAGGGCTAGGAAGTGGCCAGG + Intronic
956549493 3:70442065-70442087 ACCATAGCTGGGAAGGTGCTGGG - Intergenic
956878134 3:73483847-73483869 AAAAAGGCTGTGAAGGGCCTTGG + Intronic
957900908 3:86488728-86488750 ACCAGGGCCGGACAGGGGCTGGG - Intergenic
958534857 3:95387415-95387437 CCCAGGGCTGGGAAGTGCAGTGG + Intergenic
960937346 3:122912133-122912155 GCCAGGGCTGGGAAGCGACATGG - Intronic
960937583 3:122913055-122913077 ACCAGGGCTGCGGAGGGGCTAGG + Exonic
961937407 3:130599950-130599972 ACCAGGGCTGGCAAAGGACTTGG + Intronic
961996369 3:131248542-131248564 ACCAGGGCTGGTGAGGGACAAGG + Intronic
962403678 3:135082264-135082286 ACATGGGCTGGGCAGGACCTTGG + Intronic
962837771 3:139204068-139204090 GGCAGAGCTGGGGAGGGCCTTGG - Intronic
963084860 3:141427455-141427477 CCCTGGGCTGGGAAGGCCCCAGG + Intronic
963783732 3:149512369-149512391 ACCAGGGCTGGGAATAGGATGGG - Intergenic
964466353 3:156997488-156997510 AGTAGGTCTGGGTAGGGCCTAGG + Intronic
966417782 3:179707267-179707289 TTCAGGGCAGGGAAGGGCTTAGG - Intronic
966916685 3:184588099-184588121 ACCTGGGCTTGGAAAGGCCATGG - Intronic
967098009 3:186193529-186193551 ACCCAGGCTGGTAAGAGCCTTGG + Intronic
968461212 4:725977-725999 ACCATGGCTCGGAAGAGGCTGGG - Intronic
968521833 4:1037683-1037705 ACCAGGGGCGGGCGGGGCCTGGG - Intergenic
968737277 4:2303953-2303975 ACCAGGGGCGGGATGGGCCGGGG + Intronic
968964222 4:3761390-3761412 CTCAGGGCTGGCATGGGCCTCGG + Intergenic
969058531 4:4416755-4416777 ACCAGAGCAGAGAGGGGCCTTGG - Intronic
969422910 4:7107665-7107687 CCCAGGGCTGGGGAGTGCCATGG + Intergenic
969478099 4:7432624-7432646 ACCAGGGCAGCGGAGGGTCTGGG + Exonic
971655583 4:29340220-29340242 ACCAGGGCTGGGAAGGGTAGTGG - Intergenic
973623759 4:52751438-52751460 ACGAGGGCTGGGAAGATCCTGGG + Exonic
973623771 4:52751470-52751492 AGCGGGGCTGGGAAGATCCTGGG + Exonic
973654863 4:53036214-53036236 ACCAGGGCTGGTCAGGGGATTGG - Intronic
976602421 4:86950113-86950135 AGCAGGGCAGGGATGGGACTTGG + Intronic
976820215 4:89197898-89197920 AGCATGGCTGGGGAGGGCTTAGG - Intergenic
977368373 4:96102080-96102102 ACCAGGGGAGGGAGGGGCCAGGG + Intergenic
978584407 4:110262068-110262090 ACCGGGGCTGGGAAGGGTGGTGG - Intergenic
979396727 4:120197937-120197959 ACCAGAGCTGGGAATGTGCTGGG - Intergenic
981285591 4:143015432-143015454 AACATGGCTGGGGAGGGCTTAGG + Intergenic
981800315 4:148648063-148648085 CCCAGGGCTGGGAGGGGCTGAGG + Intergenic
982521371 4:156420616-156420638 AGCAAATCTGGGAAGGGCCTGGG + Intergenic
984964393 4:185127935-185127957 ACCAGGGCTTGGAAGACCCTCGG + Intergenic
985289513 4:188373665-188373687 CCTAGGACTGGGAAGAGCCTGGG + Intergenic
985493965 5:194087-194109 TTCAGAGCTGGGAAGGGCCATGG - Intronic
985573298 5:662188-662210 GCCAGGTCTGGGAAGGGCTGTGG + Exonic
985665928 5:1181534-1181556 GCCAGGACTGGGGAGGGGCTCGG - Intergenic
985714633 5:1448472-1448494 ACTGGTGCTGGGAAGGCCCTGGG + Intergenic
985805326 5:2039008-2039030 GGCAGGGCTGGGCAGGGGCTTGG + Intergenic
986513109 5:8529656-8529678 ACCATGGCTGGGGAGGATCTAGG - Intergenic
986806050 5:11309971-11309993 AGCAGGGCTGGGGAGGCCCCAGG - Intronic
987264648 5:16240346-16240368 ACCAGAGCTGGGAAGGGAAGAGG + Intergenic
988041065 5:25889272-25889294 AGCATGGCTGGGGAGGGCTTAGG + Intergenic
988608518 5:32703437-32703459 ACCATGGCTGGGAATGTGCTGGG + Intronic
988716835 5:33836786-33836808 ACCAGGGCTGGGAAAGAGCACGG + Intronic
989167548 5:38446142-38446164 ACCATGGCTGGGAAGGGAGAAGG - Intronic
990003666 5:50922340-50922362 AGGAGGGATGGGCAGGGCCTGGG - Intergenic
991439043 5:66627101-66627123 AGCAGGGCTGGGGAGGCCTTAGG + Intronic
991621340 5:68548580-68548602 ACCAGGGAAGGGGAGGCCCTAGG - Intergenic
992626186 5:78637774-78637796 AGCAGGGCTGGGTAGGGCCTAGG - Intronic
993042047 5:82825202-82825224 TCTAGGGCTGTGATGGGCCTAGG - Intergenic
993320696 5:86465354-86465376 ACCAGGCCTGGGGAGCGGCTGGG - Intergenic
995573170 5:113502947-113502969 ACCACAGCTGGGAAGGTGCTGGG + Intergenic
996471404 5:123865201-123865223 AGTAGGTCTGGGCAGGGCCTAGG - Intergenic
996663941 5:126035930-126035952 AGCAAGGCTGGGAAGGGCTCAGG + Intergenic
996796391 5:127352933-127352955 GCAAGAGCTAGGAAGGGCCTGGG - Intronic
996956466 5:129188415-129188437 TCCAGGGCTGGGATGGGGATAGG + Intergenic
997425921 5:133802544-133802566 ACCAGAGCTGGGAAAGGGCCTGG + Intergenic
997641086 5:135449406-135449428 CCCAAGTCTGGGAAGGGCCGTGG + Exonic
998132342 5:139657744-139657766 GCCTGGGCTGGGACTGGCCTGGG + Intronic
998149838 5:139750643-139750665 GCCAGGGGTGGGAGGGGCTTGGG - Intergenic
998170537 5:139869906-139869928 GCCAGGGCTGAGGAGGGCCATGG - Intronic
998184590 5:139968581-139968603 AGGAGGGCTGGGAAGGGCAGAGG + Intronic
998393077 5:141800244-141800266 ACCAGCGCTGGGAAGTGCCTTGG + Intergenic
999257558 5:150218013-150218035 ACCAGGGCAGGGGAGGCCCCTGG + Intronic
999262025 5:150244381-150244403 CCCAGGGCTGGGATGTGCCCAGG - Intronic
1001159633 5:169301315-169301337 ACCAGGGAAGGAAAGGGGCTCGG + Intergenic
1001220867 5:169899594-169899616 AGCAGGACTAGGAAGGCCCTGGG + Intronic
1001429135 5:171645818-171645840 CAAAGAGCTGGGAAGGGCCTGGG + Intergenic
1001731687 5:173964836-173964858 GCCAAGGCTGGGATGTGCCTAGG + Intergenic
1001929472 5:175662531-175662553 ACCAGTGCTTTGAAGGCCCTTGG - Intronic
1002469909 5:179428973-179428995 ATCAGGGCTGGGAGGAGCCCTGG + Intergenic
1002535369 5:179872858-179872880 AGCAGGGCTGGGCAGGGGCTGGG - Intronic
1002617393 5:180464300-180464322 ACAGGTGCTGGGAAGGGCCAGGG - Intergenic
1002822328 6:737001-737023 ACCAGGGCCGGGCTGTGCCTCGG - Intergenic
1002871373 6:1169921-1169943 CCCTGGCCTGGGAGGGGCCTGGG + Intergenic
1003480302 6:6525117-6525139 AGCAGGGCTGGGAAGGGAAGAGG + Intergenic
1003950514 6:11111481-11111503 TGCAGGGGTGGGAAGGACCTTGG - Intronic
1004145028 6:13058044-13058066 ACAAGCCCTGGGCAGGGCCTCGG - Intronic
1004238554 6:13897688-13897710 ACCTGGGTAGGGAAGGGCCCTGG + Intergenic
1004893186 6:20121584-20121606 ACCTGGACTGGGAAGTGCCATGG - Intronic
1004905828 6:20236102-20236124 CCCAGGGCTGGAAAGGCCTTGGG - Intergenic
1005716736 6:28556464-28556486 CCCAGGACTGGCAAGGGCATTGG - Intergenic
1005972032 6:30769180-30769202 CCCAGGGCTGGGATGTGACTTGG - Intergenic
1006061317 6:31421972-31421994 ACCAGGGCTGGGAATGCAGTGGG - Intergenic
1006370993 6:33643446-33643468 TCCAGAGCTGGCAAGGCCCTGGG + Intronic
1006514965 6:34540789-34540811 ACCAGGGCTGGGAGTGGGTTGGG + Intronic
1007946432 6:45831248-45831270 GCCTGGGCTGGGAGGGGCTTTGG + Intergenic
1008071774 6:47105573-47105595 ACCAGGGCTGGCAGGGGTGTTGG - Intergenic
1009375280 6:62960995-62961017 ACCAGAGCTGGGAATGTGCTAGG + Intergenic
1010003493 6:70971337-70971359 AGCCGGTCTGGGTAGGGCCTGGG + Intergenic
1012908578 6:105094509-105094531 ACTGGGTATGGGAAGGGCCTTGG + Intergenic
1013599550 6:111691612-111691634 GCCAGGGCAGGGCAGGCCCTCGG + Intronic
1015852611 6:137589368-137589390 AGCAAAGCTGGGTAGGGCCTGGG - Intergenic
1016750401 6:147625168-147625190 CCCAGGCCTGAGAAGGGCCCAGG + Intronic
1017724824 6:157269615-157269637 ACCACGGCAGGGAGGGGCCTGGG - Intergenic
1018387732 6:163320150-163320172 TCCAGGGCCCGGAAGGACCTTGG + Intergenic
1018813709 6:167316316-167316338 GGGAGGGCTGGGGAGGGCCTGGG - Intergenic
1018826942 6:167415571-167415593 ACCGGGCCTGGGAAGGCCATTGG - Intergenic
1019184120 6:170211141-170211163 ACCAGGGCCAGGTAGGGCCTTGG - Intergenic
1019513300 7:1429130-1429152 GCCAGGGCTGGGAAGGCCTCAGG - Intronic
1019587343 7:1812754-1812776 GCCAGGGCTGGGCAGGGACAGGG + Intergenic
1019601522 7:1886027-1886049 ACGAGGGCTGGTGAGGGCCCAGG - Intronic
1019706409 7:2499145-2499167 TCCAGGCCTGGGAATGGGCTGGG + Intergenic
1019819945 7:3234975-3234997 AGGATGGCTGGGGAGGGCCTTGG - Intergenic
1019925812 7:4191236-4191258 ACCGCGGCGGGGGAGGGCCTGGG - Intronic
1019983918 7:4641695-4641717 AGCAGGGCTGGGAAGGGCGAGGG + Intergenic
1020071887 7:5232601-5232623 AGCAGGGATGAGAAGGGCCGCGG + Exonic
1020096780 7:5374060-5374082 AACAGGGCCTGGAAGGGGCTGGG + Exonic
1021704526 7:23353524-23353546 AGCAGTTCTGGGAAGGGCCTTGG - Intronic
1021844054 7:24746838-24746860 CCCAGGGCTGTGAAGGGTGTAGG - Intronic
1022140715 7:27491304-27491326 TCCAGGCCTGGGATGGACCTAGG + Intergenic
1022442868 7:30448175-30448197 CCCAGGGCTGGGAAGAGCGCTGG - Intronic
1022519245 7:30995237-30995259 ACCTGACCTGGGAAGGGCCAAGG - Intergenic
1022892267 7:34713776-34713798 GACAGGCCTGGGATGGGCCTAGG - Intronic
1022981728 7:35610773-35610795 AACATGGCTGGGAGAGGCCTGGG - Intergenic
1023030813 7:36089234-36089256 ACCAAGGCTGGGCAGGGCAGCGG - Intergenic
1023238933 7:38121580-38121602 ACCAGGACTGGGAGGGACTTGGG + Intergenic
1023290548 7:38664290-38664312 GGCAGGGCAGGGCAGGGCCTAGG + Intergenic
1023867928 7:44247592-44247614 ACCAAGGCAGGGAAGGGTCAAGG + Intronic
1023940325 7:44765257-44765279 CCCAGGGCTGGGAGGGGCAGTGG + Intronic
1023968424 7:44975420-44975442 CCCAGGCCTGGGATGGGTCTCGG + Intronic
1023986482 7:45100117-45100139 ACCAAGCCTGGGAAGGCCCCAGG + Exonic
1024051286 7:45624958-45624980 AGCAGGACTGCAAAGGGCCTGGG - Intronic
1024568840 7:50707752-50707774 AGCAGGGCTGTGCAGGCCCTGGG - Intronic
1027266699 7:76498597-76498619 ACCAGGGCTGGGCAGAGGCGAGG + Intronic
1027318079 7:76996714-76996736 ACCAGGGCTGGGCAGAGGCGAGG + Intergenic
1029473458 7:100768756-100768778 GCTGGGCCTGGGAAGGGCCTCGG + Intronic
1029506633 7:100967022-100967044 ACCAGGGCAGGGAGGGGGCTGGG + Intronic
1029665731 7:101993888-101993910 AGGAGCGCTGGGAATGGCCTAGG - Intronic
1030881491 7:114886111-114886133 CCCAGGGATGGGTATGGCCTTGG - Intergenic
1031418396 7:121520327-121520349 GTCAGGGCTGGGGAGGCCCTTGG - Intergenic
1032068614 7:128790930-128790952 GGCAGGGGTGGGCAGGGCCTGGG + Intronic
1032174542 7:129612271-129612293 ACGAGAGCCGGGAAGGGCCGAGG - Intronic
1032431055 7:131861842-131861864 AACAGGGCTGGGCAGGCCCCAGG - Intergenic
1032691365 7:134290490-134290512 TCCAGGGATGGGAGGGGCCAGGG - Exonic
1032820196 7:135517419-135517441 ACCAGGGCAGGGCTGGGACTAGG + Intergenic
1032962386 7:137051513-137051535 ACCAGGTCTAGGAAAGTCCTTGG - Intergenic
1033267896 7:139901844-139901866 AGCAGGCCTGGGTAGGGCCCAGG - Intronic
1034350426 7:150411544-150411566 ACCAGGGCTGGGATGGGTTTGGG + Intronic
1034741134 7:153474592-153474614 ACCTTGGCTGGGCAGGGCCCAGG - Intergenic
1035235472 7:157495006-157495028 TCCAGAGCTGGGAGGGGCTTTGG + Intergenic
1035356089 7:158276760-158276782 GCCATGGCTGGGAAGGACGTCGG + Intronic
1035492999 7:159296127-159296149 ATCAGAGGTGGGGAGGGCCTTGG + Intergenic
1035848597 8:2891456-2891478 ACCAGTGCCAGGAAGAGCCTAGG + Intergenic
1036567412 8:9949297-9949319 ACAAGGGCTGAGAAGTCCCTAGG - Intergenic
1036683559 8:10893575-10893597 GCCACGGCTGGGGAGGGACTGGG + Intergenic
1036808985 8:11854217-11854239 TCCAGGGCTGGGGAGAGCCGCGG + Intronic
1037583596 8:20261451-20261473 ACCAGGACGGGGAGGGGCCCGGG + Intronic
1037640882 8:20742107-20742129 TCCAGTGCTGGGAACTGCCTTGG + Intergenic
1037986794 8:23295204-23295226 CATAGGGCCGGGAAGGGCCTGGG + Intronic
1038704011 8:29877237-29877259 AGCATGGCTGGGAAGGCCTTAGG + Intergenic
1039214208 8:35251223-35251245 AACATGGCTGGGTAGGCCCTAGG + Intronic
1039898567 8:41734140-41734162 CTCAGGGCTGGGAAGGGGCCTGG - Intronic
1040073556 8:43206993-43207015 AACAGGGGTGAGAAGGTCCTGGG + Intergenic
1044807223 8:96020840-96020862 ACCGGAGCTGAGAAGGGCCTGGG + Intergenic
1044923016 8:97185704-97185726 ACAAGGGGTGGGGAGGGCATGGG + Intergenic
1047248734 8:123166101-123166123 ATCAGGGCCGGGAGGGGGCTGGG + Intergenic
1047389450 8:124438300-124438322 ACCAGGGCTGTTAAGGTCCTTGG - Intergenic
1048256612 8:132909682-132909704 ACCAAGCCTGGGAAAGGCCCAGG - Intronic
1048304330 8:133273064-133273086 ACCAGGGCCGGGCAGGGCTCTGG - Intronic
1048379634 8:133853868-133853890 AACAAGGCTGGGCAGGGCCTGGG - Intergenic
1048532825 8:135265776-135265798 AGCATGGCTGGGGAGGCCCTAGG - Intergenic
1049020082 8:139950611-139950633 ACCAGTTCTTGGAAGGCCCTTGG - Intronic
1049514367 8:143045619-143045641 ACCAGGCCTGGGAGGGTCCTGGG - Intronic
1049751490 8:144286399-144286421 GCCACGGCAGGGCAGGGCCTCGG + Intronic
1049751507 8:144286464-144286486 GCCACGGCAGGGCAGGGCCTCGG + Intronic
1049751524 8:144286529-144286551 GCCACGGCAGGGCAGGGCCTCGG + Intronic
1049751540 8:144286594-144286616 GCCATGGCAGGGCAGGGCCTCGG + Intronic
1051141115 9:13979858-13979880 ACCAGGGGTGGGAAAGTCCAAGG - Intergenic
1052851601 9:33381594-33381616 ACCAGGGCTGGGAGTGACCAGGG - Intergenic
1053110205 9:35453338-35453360 ACCACGGCTGGGAATGTGCTGGG - Intergenic
1053479046 9:38402546-38402568 AACAGTGCTGGGAAGGGAATAGG + Intergenic
1054401568 9:64717048-64717070 GCCAGGGCAGGGCAGGGCCAGGG - Intergenic
1054705340 9:68455670-68455692 ACCAGGGCTGTGGAGGAACTTGG - Intronic
1054881708 9:70151091-70151113 CCCTGGGCTAGGAAAGGCCTTGG - Intronic
1056546039 9:87614810-87614832 CCCAGGGCCTGGAAGGGACTTGG - Intronic
1056577117 9:87864143-87864165 TCCAGGGCCGGGAAGAGCCTGGG + Intergenic
1056702247 9:88920516-88920538 ACCTGGGCTGGGAAGGGATAAGG + Intergenic
1056711319 9:88994193-88994215 CACAGAGCTGGGAAGGGGCTGGG - Exonic
1057008288 9:91580374-91580396 TGCAGGGCTGAGAAGGGCCAGGG - Intronic
1057081460 9:92177224-92177246 ACAAGGGCTGCGCAGGGCCCAGG + Intergenic
1057169188 9:92950678-92950700 ACCAGGGGTCAGAAGGGACTCGG - Intronic
1057421267 9:94914813-94914835 AGTAGGCCTGGGTAGGGCCTAGG - Intronic
1057569657 9:96194765-96194787 AACTGGGCTGGGAAAGGCCGAGG + Intergenic
1058301449 9:103378769-103378791 AGCAGGGCTAGGATTGGCCTGGG - Intergenic
1058557885 9:106189583-106189605 ACCAGAGATGGGAAGGGCAGTGG - Intergenic
1059446293 9:114340163-114340185 ACCAGGGCTGGATGGCGCCTTGG + Intronic
1060188606 9:121578494-121578516 CCCGGGGCTTGGAAGGGCCACGG - Intronic
1060251068 9:121987171-121987193 CCCAGGGCTGGGCAGGGACATGG + Intronic
1060661935 9:125409463-125409485 CCCAGGGCTGGGAGGCGCCCTGG + Intergenic
1060695751 9:125707361-125707383 TCCAGTGCAGGGAAAGGCCTGGG + Intergenic
1060810689 9:126610202-126610224 ACCAGGGCTGCAGAGAGCCTGGG - Intergenic
1061071001 9:128310716-128310738 GCCAGGGCTGGGAAGGAAGTCGG + Intronic
1061181286 9:129026635-129026657 ACCTAGGCAGGGCAGGGCCTAGG - Intronic
1061707118 9:132461693-132461715 GCCAGGCCTGGGAAGGGCCCAGG - Intronic
1061965395 9:134011024-134011046 ACCAGGGCTCAGAAGGGCAGTGG + Intergenic
1062003953 9:134230067-134230089 ACGAAGGCAGGGCAGGGCCTAGG + Intergenic
1062044698 9:134419608-134419630 CCCAGCGCGGGGCAGGGCCTGGG + Intronic
1062334324 9:136058350-136058372 TCCCTGGCTGGGAAGGGCCTGGG - Intronic
1062358653 9:136177155-136177177 ACCTGGGCTGGCAAGGCCCCTGG - Intergenic
1062390639 9:136332360-136332382 TTCTGGCCTGGGAAGGGCCTGGG - Intronic
1062400340 9:136370006-136370028 TGCAGGGCTGGTAGGGGCCTGGG - Intronic
1062453244 9:136624238-136624260 ACCAGGGAGGGACAGGGCCTTGG - Intergenic
1062473370 9:136715960-136715982 CCGCGGGCTGGGAAGGGACTGGG - Intronic
1185848736 X:3465248-3465270 AGCAGGGTTGGGAGGGCCCTGGG - Intergenic
1185920423 X:4085579-4085601 ACCAGAGCTGGGAAGGGGAAAGG - Intergenic
1186512798 X:10143151-10143173 AGCAGCGCTGGGAAGGACCCAGG - Exonic
1187462764 X:19502485-19502507 AGCATGGCTGGGGAGGGCTTAGG - Intronic
1187648536 X:21375102-21375124 TCCAGGACTGGCAGGGGCCTGGG + Intronic
1188538716 X:31225701-31225723 AGTAGGTATGGGAAGGGCCTGGG + Intronic
1189234440 X:39476720-39476742 AGCAGTGCTGGGAAGGGAGTGGG + Intergenic
1189969340 X:46402047-46402069 ACGAGGGCAGGGAAGGGACCTGG + Intergenic
1190947317 X:55108682-55108704 ACCAGGGCTGGGGAGTGAGTGGG + Intronic
1190971888 X:55357323-55357345 TCCAGGGGTGGGAGGGGCCCAGG + Intergenic
1192261637 X:69509167-69509189 GCCAGGGCGGGGAAGGGCATCGG - Intronic
1192505658 X:71680608-71680630 ACCACAGCTGGGAATGCCCTGGG + Intergenic
1192927091 X:75766832-75766854 ACCAGAGCTGGGAATGTGCTGGG - Intergenic
1194429873 X:93788864-93788886 GACAGAGCTGGGAAGGGCCTTGG - Intergenic
1194529240 X:95024428-95024450 ACCAGGGGTGGGAGGGGGTTGGG - Intergenic
1195328203 X:103775158-103775180 AGCAGGGCTGGGGAGGGCGAGGG + Intronic
1196284422 X:113863376-113863398 TCCAGGCGTGGGAGGGGCCTGGG - Intergenic
1196442154 X:115727705-115727727 AGCAGGCCTGGGAAGGCCCCGGG + Intergenic
1196442814 X:115730659-115730681 AGCAGGCCTGGGAAGGCCCCGGG + Intergenic
1196443408 X:115733209-115733231 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196444114 X:115736728-115736750 AGCAGGCCTGGGAAGGCCCCGGG + Intergenic
1196445732 X:115845129-115845151 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196446403 X:115848110-115848132 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196447074 X:115851091-115851113 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196447743 X:115854074-115854096 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196448413 X:115857053-115857075 AGCAGGCCTGGGAAGGCCCCAGG - Intergenic
1196449082 X:115860044-115860066 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196449753 X:115863035-115863057 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196450422 X:115866018-115866040 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196451092 X:115869003-115869025 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196451763 X:115871982-115872004 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196452434 X:115874969-115874991 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196453104 X:115877938-115877960 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196453774 X:115880931-115880953 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1196454443 X:115883940-115883962 AGCAGGCCTGGGAAGGCCCCAGG - Intergenic
1196455518 X:115889002-115889024 AGCAGGCCTGGGAAGGCCCCGGG - Intergenic
1197487733 X:127074736-127074758 ACCATAGCTGGGAATGGCCTGGG + Intergenic
1198030260 X:132747684-132747706 ATTAGGGCTGGAAGGGGCCTTGG - Intronic
1198571040 X:137957254-137957276 CTCAGTGCTGGGAAGGGCTTTGG + Intergenic
1198575387 X:138004882-138004904 GCAAGGGCAGGGAAGGGCCTAGG - Intergenic
1198812097 X:140546424-140546446 TCTAGAGCTGGGAAGTGCCTTGG + Intergenic
1200141129 X:153903656-153903678 AACAGGGCCGGGAGGGGCCAGGG + Intronic
1200267076 X:154652463-154652485 ACCAGGACAGGGAAGGCGCTGGG - Exonic
1200814907 Y:7521582-7521604 AGCAGGGTTGGGAGGGCCCTGGG + Intergenic
1201500978 Y:14642355-14642377 TCCAGGGTTGGGAAGAGACTGGG - Intronic