ID: 1084164119

View in Genome Browser
Species Human (GRCh38)
Location 11:67367122-67367144
Sequence TCTCTTGCGCGGGCGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084164119_1084164134 28 Left 1084164119 11:67367122-67367144 CCCAACCCCGCCCGCGCAAGAGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1084164134 11:67367173-67367195 CTTCCCCGGCCCCCAGGGGGAGG 0: 1
1: 0
2: 1
3: 33
4: 361
1084164119_1084164130 22 Left 1084164119 11:67367122-67367144 CCCAACCCCGCCCGCGCAAGAGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1084164130 11:67367167-67367189 AGGAGACTTCCCCGGCCCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 211
1084164119_1084164128 2 Left 1084164119 11:67367122-67367144 CCCAACCCCGCCCGCGCAAGAGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1084164128 11:67367147-67367169 CCACAACACGGTGTAAACAGAGG 0: 1
1: 0
2: 0
3: 1
4: 69
1084164119_1084164132 24 Left 1084164119 11:67367122-67367144 CCCAACCCCGCCCGCGCAAGAGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1084164132 11:67367169-67367191 GAGACTTCCCCGGCCCCCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 184
1084164119_1084164126 -10 Left 1084164119 11:67367122-67367144 CCCAACCCCGCCCGCGCAAGAGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1084164126 11:67367135-67367157 GCGCAAGAGACACCACAACACGG 0: 1
1: 0
2: 0
3: 2
4: 78
1084164119_1084164129 14 Left 1084164119 11:67367122-67367144 CCCAACCCCGCCCGCGCAAGAGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1084164129 11:67367159-67367181 GTAAACAGAGGAGACTTCCCCGG 0: 1
1: 0
2: 0
3: 18
4: 178
1084164119_1084164131 23 Left 1084164119 11:67367122-67367144 CCCAACCCCGCCCGCGCAAGAGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1084164131 11:67367168-67367190 GGAGACTTCCCCGGCCCCCAGGG 0: 1
1: 0
2: 2
3: 16
4: 234
1084164119_1084164133 25 Left 1084164119 11:67367122-67367144 CCCAACCCCGCCCGCGCAAGAGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1084164133 11:67367170-67367192 AGACTTCCCCGGCCCCCAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084164119 Original CRISPR TCTCTTGCGCGGGCGGGGTT GGG (reversed) Intronic
901653526 1:10756305-10756327 TGTCTTGCGGGGGCGAGGGTGGG - Intronic
906107790 1:43305100-43305122 TCTCCTGCGTGGGCGGTGCTGGG + Exonic
922762203 1:228140230-228140252 TCTCGCGCGCGGGCGGAGGTGGG + Intronic
1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG + Exonic
1072021760 10:91410024-91410046 TCTCCTGCGCGGCCCGGGTGCGG + Intergenic
1075555770 10:123430687-123430709 TCTCTTGCGGGGGGTGGGTGGGG + Intergenic
1084053468 11:66616323-66616345 TCTCTGGCCCGGGTGGGGCTGGG - Intergenic
1084164119 11:67367122-67367144 TCTCTTGCGCGGGCGGGGTTGGG - Intronic
1094945789 12:35841954-35841976 TCTCTTGCGATGGAGGAGTTTGG + Intergenic
1100898225 12:99209835-99209857 TCTCTTGCCGGGAAGGGGTTTGG - Intronic
1101478642 12:105075583-105075605 TTTTTTGCGGGGGCGGGGTGTGG - Intronic
1101682974 12:106987186-106987208 TGTCTTGGGGGGGCGGGGGTTGG - Intergenic
1101817702 12:108158455-108158477 TCCCTGGGGCGGGCGGGGTGGGG + Intronic
1101870573 12:108562433-108562455 TCTCGGGGGCGGGCGGGGTCGGG - Intergenic
1110711857 13:78658958-78658980 TCTCGTGCGGGGGCGGGGAAGGG - Intronic
1111241097 13:85476068-85476090 TCACATGGGCGGGGGGGGTTAGG + Intergenic
1113431134 13:110251300-110251322 TGTCTTGCGTGGGCTGGGCTTGG - Intronic
1122429117 14:101628852-101628874 TCTCTTGCGTGTGTGGGGATTGG - Intergenic
1132694374 16:1195354-1195376 GCTCTTGCGGGGCTGGGGTTGGG + Intronic
1137256268 16:46777990-46778012 GCTCTTGTGGGGGCGGGGTGTGG + Intronic
1151341358 17:73473070-73473092 GCTTTTGGGCTGGCGGGGTTGGG + Intronic
1160921677 19:1523758-1523780 TCTCTCGCGCGTGGGGGGTTGGG - Intergenic
1163463913 19:17455265-17455287 TCTCTTACGGGGGCGGGGCGGGG + Intronic
1163548071 19:17950994-17951016 TCCGTGGCGCGGGCGGGGCTCGG - Intergenic
937966611 2:127516335-127516357 TGTATTGCGGGGGCGGGGTGCGG - Intronic
942505462 2:176637678-176637700 CCTCGTGCGTGGGCGGGGATCGG + Intergenic
948823337 2:240561192-240561214 TCTCTCGTGAGGGCGGGCTTAGG + Intronic
1174452747 20:50629859-50629881 GGTCTTCCACGGGCGGGGTTGGG - Intronic
1174804114 20:53592512-53592534 TTTCTTGGGCGGGTGGGGGTGGG - Intronic
1175444401 20:59010139-59010161 TTCCTTGTGGGGGCGGGGTTGGG + Intergenic
1179185120 21:39079707-39079729 GCTCTTGCAGGGGTGGGGTTGGG - Intergenic
1179326866 21:40355073-40355095 TCTGTTGGGCGGGTGGTGTTGGG + Intronic
1183745299 22:39688331-39688353 TCTCTGGAGCGGGCAGTGTTGGG - Exonic
950024814 3:9812990-9813012 TCTCTTGCGCCGGAGGGGCTGGG + Exonic
953994411 3:47508711-47508733 TATCTTGCGGGGGCAGGGGTGGG + Intronic
962939523 3:140113192-140113214 TCTCTTGCGAGGGCAGGAGTGGG - Intronic
1004110521 6:12713712-12713734 TTTCTTTCGAGGGAGGGGTTGGG + Intergenic
1006118913 6:31792220-31792242 TCTTTTCCCCGGGTGGGGTTGGG + Exonic
1015843945 6:137498240-137498262 ACTCTTGCGGGGGTGGGGGTGGG - Intergenic
1019469584 7:1211609-1211631 TCTCATGAGCAGGTGGGGTTGGG + Intergenic
1030909100 7:115224612-115224634 TCTCTTGATTGGGTGGGGTTTGG - Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1039887863 8:41665425-41665447 TCTCTGGGCAGGGCGGGGTTAGG - Intronic
1056405975 9:86275459-86275481 TCTCCTGCCCTGTCGGGGTTGGG + Intronic
1188077990 X:25803246-25803268 TTTTTTGCGGGGGCGGGGCTAGG - Intergenic